<?xml version='1.0' encoding='UTF-8'?><?xml-stylesheet href="http://www.blogger.com/styles/atom.css" type="text/css"?><feed xmlns='http://www.w3.org/2005/Atom' xmlns:openSearch='http://a9.com/-/spec/opensearchrss/1.0/' xmlns:georss='http://www.georss.org/georss' xmlns:gd='http://schemas.google.com/g/2005' xmlns:thr='http://purl.org/syndication/thread/1.0'><id>tag:blogger.com,1999:blog-4884613931214794576</id><updated>2012-02-06T19:27:43.247-08:00</updated><category term='detection of aneuploidy'/><category term='Filter Membrane-Vesicle Interaction Study by Scanning Electron Microscopy'/><category term='transport'/><category term='DNA Chips for the Clinical Laboratory'/><category term='dna amplification Result'/><category term='Alternative splicing of mRNA from a single genetic locus'/><category term='Purification of polysome-engaged mRNA'/><category term='RNA Reference Materials for Gene Expression Studies'/><category term='Bicistronic mRNAs'/><category term='Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood'/><category term='mRNA stability'/><category term='Topology of a typical mRNA molecule'/><category term='Bioelectronic DNA'/><category term='Sesbania grandiflora; Phytochemical constituents; Acute toxicity'/><category term='Trans -splicing: mRNA repair'/><category term='Ofloxacin Evaluation'/><category term='dna amplification'/><category term='DNA– Protein  Interactions'/><category term='RNA polymerases and the products of transcription'/><category term='fungi in the synthesis of  nanoparticle'/><category term='Messenger RNA'/><category term='Dose for extended  release Levofloxacin ocular'/><category term='Tramadol | analgesic | pain | cyclooxygenase'/><category term='Advantages of Ethosomes'/><category term='SYNTHESIS AND CHARACTERIZATION OF SILVER NANOPARTICLES  BY RHIZOPUS STOLONIER'/><category term='Vesicle-Skin Interaction Study by Fluorescence Microscopy'/><category term='Ocular Inserts; Eye Infection; ophthalmic inserts'/><category term='Ethosomes; Transdermal drug delivery; Ethosomal encapsulation; Ethosomes effects'/><category term='Forensic botany'/><category term='Types of RNA'/><category term='and turnover'/><category term='DESIGN AND CHARACTERIZATION OF SUSTAINED RELEASE LEVOFLOXACIN'/><category term='Spherical crystallization | Flowability | Compactability | Bioavailability'/><title type='text'>BioElectronics !!</title><subtitle type='html'>RNA (rRNA), transfer RNA (tRNA), heterogeneous nuclear RNA (hnRNA), or messenger RNA (mRNA), as well as a collection of small RNAs of previously unknown function. DNA  Models, Helical Model of DNA, Nucleus of DNA, RNA and DNA in Cell, Mitochondria of Cell, Double Helix DNA &amp;amp; RNA</subtitle><link rel='http://schemas.google.com/g/2005#feed' type='application/atom+xml' href='http://bioelectronic.blogspot.com/feeds/posts/default'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default?max-results=100'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/'/><link rel='hub' href='http://pubsubhubbub.appspot.com/'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author><generator version='7.00' uri='http://www.blogger.com'>Blogger</generator><openSearch:totalResults>68</openSearch:totalResults><openSearch:startIndex>1</openSearch:startIndex><openSearch:itemsPerPage>100</openSearch:itemsPerPage><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-2987315359212313201</id><published>2012-02-06T19:24:00.000-08:00</published><updated>2012-02-06T19:27:43.261-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Ofloxacin Evaluation'/><title type='text'>Ofloxacin Evaluation</title><content type='html'>&lt;div style="text-align: center;"&gt;&lt;span style="font-weight: bold;font-size:180%;" &gt;Ofloxacin Evaluation &lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;br /&gt;&lt;div style="text-align: justify; font-family: verdana;"&gt;Most ocular treatments like eye drops and suspensions call for the topical administration of ophthalmically active drugs to the tissues around the ocular cavity. These dosage forms are easy to instill but suffer from the inherent drawback that the majority of the medication they contain is immediately diluted in the tear film as soon as the eye drop solution is instilled into the culde-sac and is rapidly drained away from the precorneal cavity by constant tear flow and lacrimo-nasal drainage.&lt;br /&gt;The eye as a portal for drug delivery is generally used for local  therapy against systemic therapy in order to avoid the risk of eye  damage from high blood concentrations of the drug, which is not  intended. The unique anatomy, physiology and biochemistry of the eye  render this organ impervious to foreign substances, thus presenting a  constant challenge to the formulator to circumvent the protective  barriers of the eye without  causing permanent tissue damage [‎ 1].&lt;br /&gt;Therefore,  only a very small fraction of the instilled dose is absorbed by the target tissue for this reason, concentrated solutions and frequent dosing are required&lt;br /&gt;for the instillation to achieve an adequate level of therapeutic effect. One of the new classes of drug delivery systems,  ocular inserts, which are gaining worldwide praise, release drugs at a pre-programmed rate for a longer period by increasing the precorneal residence time [‎ 2-‎ 4].&lt;br /&gt;Ofloxacin is a pale yellow or bright yellow, crystalline powder. Ofloxacin is antibacterial and is the most commonly used fluroquinolone.  It inhibits the enzyme  bacterial DNA gyrase, which nicks double stranded DNA, introduces negative supercoils and then reseals the nicked ends. This is necessary to prevent excessive positive supercoiling of the strands when they separate to permit replication or transcription. The bactericidal action probably results from digestion of DNA by exonucleases  whose production is signaled by the damaged DNA&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-2987315359212313201?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2987315359212313201'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2987315359212313201'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/02/ofloxacin-evaluation.html' title='Ofloxacin Evaluation'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6447916681840447369</id><published>2012-02-06T19:23:00.001-08:00</published><updated>2012-02-06T19:23:35.575-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Tramadol | analgesic | pain | cyclooxygenase'/><title type='text'>Tramadol | analgesic | pain | cyclooxygenase</title><content type='html'>Tramadol | analgesic | pain | cyclooxygenase&lt;br /&gt;&lt;br /&gt;&lt;div style="text-align: justify; font-family: trebuchet ms;"&gt;pain is defined by the International Association for the Study of Pain (IASP) as "an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage".Pain has now been equated to a “fifth vital sign” highlighting the significance of pain management in patient care. Tramadol is a centrally acting analgesic, structurally related to codeine and morphine .It is effectively used to treat moderate-to-severe acute and chronic pain in diverse conditions. Tramadol is placed on the second step of WHO analgesic ladder and in contrast to traditional opioids, exerts its analgesic activity, a dual mechanism of action inhibiting transmission as well as perception of pain. Tramadol is more suitable than NSAIDs and coxibs for patient with GI, renal and cardiovascular problems. Combined with low dependence/abuse potential, it has proven to be of significant advantage over other agents, especially in the elderly.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6447916681840447369?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6447916681840447369'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6447916681840447369'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/02/tramadol-analgesic-pain-cyclooxygenase.html' title='Tramadol | analgesic | pain | cyclooxygenase'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6323619351801611339</id><published>2012-02-06T19:20:00.000-08:00</published><updated>2012-02-06T19:22:47.188-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Spherical crystallization | Flowability | Compactability | Bioavailability'/><title type='text'>Spherical crystallization | Flowability | Compactability | Bioavailability</title><content type='html'>&lt;div style="text-align: center;"&gt;&lt;span style="font-weight: bold;font-size:180%;" &gt;Spherical crystallization | Flowability | Computability | Bioavailability&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;br /&gt;Spherical crystallization is a particle design technique, by which crystallization and agglomeration can be carried out simultaneously in one step and which has been successfully utilized for improvement of flowability, compactability and bioavailability of crystalline drugs. General methods of spherical crystallization are spherical agglomeration, emulsion solvent diffusion and ammonia diffusion method. The principle steps involved in the process of spherical crystallization are flocculation zone, zero growth zone, fast growth zone and constant size zone. Spherical crystallization is having wide applications in pharmaceuticals like improvement of flowability and compressibility of poorly compressible drugs, masking bitter taste of drugs and improving the solubility and dissolution rate of poorly soluble drug.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6323619351801611339?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6323619351801611339'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6323619351801611339'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/02/spherical-crystallization-flowability.html' title='Spherical crystallization | Flowability | Compactability | Bioavailability'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1831445744474338658</id><published>2012-01-11T09:18:00.000-08:00</published><updated>2012-01-11T09:20:18.080-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Dose for extended  release Levofloxacin ocular'/><title type='text'>Dose for extended  release Levofloxacin ocular</title><content type='html'>&lt;div style="text-align: justify;"&gt;Dose for extended  release Levofloxacin ocular&lt;br /&gt;&lt;br /&gt;Levofloxacin is a fluoroquinolone antibacterial drug effective in the treatment of bacterial conjunctivitis and other ocular  infections. Levofoxacin eye drop is available in the market for the treatment of anti bacterials&lt;br /&gt;12.One drop of levofloxacin eye drop&lt;br /&gt;   = 0.05ml   (approximately)&lt;br /&gt;&lt;br /&gt;Quantity of drug instilled at one time (1-2&lt;br /&gt;drops/time)     = 250-500 µg&lt;br /&gt;&lt;br /&gt;Quantity of drug instilled in one day (6-12&lt;br /&gt;drops/ day)      = 1500-3000 µg &lt;br /&gt;&lt;br /&gt;The quantity of levofloxacin in the ocular insert can be between 1.5-3.0 mg for one day treatment using eye drops. Thus, 2.25 mg of levofloxacin is taken as the minimum required quantity for one day treatment.  It was presumed that there would be a negligible loss of drug through ocular inserts when the drug is released at a constant rate over a period of 24hrs. &lt;br /&gt;Assumption was also made that the ocular inserts will produce a better clinical response than the eye drops. &lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1831445744474338658?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1831445744474338658'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1831445744474338658'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/dose-for-extended-release-levofloxacin.html' title='Dose for extended  release Levofloxacin ocular'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-4784229558162473433</id><published>2012-01-11T09:15:00.000-08:00</published><updated>2012-01-11T09:18:46.280-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='DESIGN AND CHARACTERIZATION OF SUSTAINED RELEASE LEVOFLOXACIN'/><title type='text'>LEVOFLOXACIN DESIGN AND CHARACTERIZATION OF SUSTAINED RELEASE LEVOFLOXACIN</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;DESIGN AND CHARACTERIZATION OF SUSTAINED RELEASE LEVOFLOXACIN&lt;br /&gt;&lt;br /&gt;Levofloxacin is a fluoroquinolone antibacterial drug effective in the treatment of bacterial conjunctivitis. The objective of the present work was to develop ocular inserts of levofloxacin and evaluate their potential for sustained ocular delivery. Conventional ophthalmic solution shows the poor bioavailability and therapeutic response due t many pre-corneal constraints.&lt;br /&gt;These constrains necessitates the controlled and sustained drug delivery to become standard one in modern pharmaceutical era Matrix type ocular inserts were prepared by the film casting technique in Teflon coated Petri dishes and characterized  in vitro by drug release studies using a flow through apparatus that simulated the eye conditions. Nine formulations were developed, which differed in the ratio of olymers - chitoson, polyvinyl alcohol (PVA). All the formulations were subjected to  evaluation of thickness, weight variation, folding endurance, drug content uniformity, in vitro release study, Surface pH, Swelling Studies (Swelling Index), % Moisture absorption, Release Kinetics, and Ocular Irritation Studies.&lt;br /&gt;On the basis of in vitro drug release studies, the formulation L9 was found to be better than the other formulations and it was selected as an optimized formulation. &lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-4784229558162473433?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4784229558162473433'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4784229558162473433'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/levofloxacin-design-and.html' title='LEVOFLOXACIN DESIGN AND CHARACTERIZATION OF SUSTAINED RELEASE LEVOFLOXACIN'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-3123769965923170885</id><published>2012-01-01T09:21:00.001-08:00</published><updated>2012-01-01T09:21:44.830-08:00</updated><title type='text'>RNA Reference Materials for Gene Expression Studies</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;This flowering of ingenuity is acceptable for hunting candidate genes with one format and verifying results by more common techniques, but for clinical applications, this variety is an obstacle. The typical application envisions a multiparametric “gene-expression signature” in which the expression patterns for many genes are combined to generate a “classifier” for diagnosis or prognosis. Laboratory 1, which uses array system brand A, publishes a well-designed study showing that a gene-expression signature distinguishes benign from malignant omphalomas. How should Laboratory 2, which uses brand X, adapt the “signature”? Clinical studies are also hampered by lack of well-defined controls. This problem is analogous to deciding, without benefit of reference materials, which of two immunoassays is better—when they use independently derived antibodies and different calibrators and controls—and then making this decision for 10 000 immunoassays at once. Some suppliers already provide tools to control for variation, including replicate probes, “spike-in” RNA controls, normalization algorithms, and image-quality metrics, but these also differ among formats. For comparing results among methods, it would be decidedly helpful to have widely available, standardized, renewable pools of RNA species that could monitor RNA purification, monitor cDNA labeling, verify sensitivity, and serve as controls.&lt;br /&gt;&lt;br /&gt;During an actual assay, the APS could be cohybridized with a complex sample in two-color format. In the single-color format, the APS and the complex sample would have to be hybridized to separate arrays. The performance of a simple cRNA pool will not necessarily reflect performance of an array system with a more complex mixture. For such a format perhaps a complex sample could be labeled in parallel with and without addition of an APS, and then hybridized to separate arrays (recovery experiment).&lt;br /&gt;&lt;br /&gt;The UHS (“spike-in” controls) would provide information on efficiency of cDNA synthesis/labeling, uniformity of hybridization, and sensitivity of detection. A pool added to samples before RNA purification could monitor that process. The utility of APS and UHS for QPCR is clear. The proposed number of materials exceeds needs but will not resolve the fundamental question of how best to normalize QPCR.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-3123769965923170885?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3123769965923170885'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3123769965923170885'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/rna-reference-materials-for-gene_01.html' title='RNA Reference Materials for Gene Expression Studies'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8889164823370198399</id><published>2012-01-01T09:19:00.000-08:00</published><updated>2012-01-01T09:20:39.072-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='RNA Reference Materials for Gene Expression Studies'/><title type='text'>RNA Reference Materials for Gene Expression Studies</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;&lt;div style="text-align: center;"&gt;&lt;span style="font-weight: bold;font-size:130%;" &gt;RNA Reference Materials for Gene Expression Studies&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;br /&gt;While walking up several flights of stairs in an elevator-deprived building recently, my colleague, between some gasps of breath, turned to me and exclaimed that he had to start his New Year’s resolution and begin exercising again. At that moment this seemed to me to be a very sensible thought, given his fish-like gasping and chameleon-like color changes. However, I also recalled that my colleague had a history of serious asthma and a travel schedule that rivaled most airline pilots. I asked him how he would be managing these challenges while seeking a more healthy lifestyle. He smiled at me and said that he would deal with these issues later. “Look”, he said, “at least getting some exercise is a start”.&lt;br /&gt;&lt;br /&gt;The first steps in transitioning microarray- and quantitative reverse transcription-PCR (QRT-PCR)-based human-genome-wide RNA expression profiling from the current, primarily research, applications to the more exacting medical diagnostic and drug development arenas were made recently. The NIST organized a meeting in March 2003 (1) that focused singularly on establishing the types and properties of universal RNA reference materials to be used for expression-profiling assays. A summary of the proceedings and conclusions of the meeting is reported by Cronin et al. (2) in this issue. The principal conclusion of the workshop was that two types of RNA reference materials were needed: an Assay Process Control and an Array-Specific Hybridization reference material. The reported consensus of the meeting attendees was that such RNA reference materials would provide a measure of the accuracy, dynamic range, sensitivity, specificity, and reproducibility for the multiple types of currently available RNA expression technologies (arrays and QRT-PCR). Although acknowledging that there were several major challenges related to utilization of the proposed RNA reference materials and interpretation of results derived from their use, the authors of this report sounded a familiar refrain in their justification of focusing only on the goal of identifying and characterizing universal RNA reference materials. This was an important first step. Tackling associated implementation and interpretation issues was labeled as “beyond the scope of the March conference”. Memories of my colleague’s statement and the smile on his face came immediately to mind as the phrase “beyond the scope” was repeated several times in the report.&lt;br /&gt;&lt;br /&gt;The goal of establishing measurable parameters to evaluate the performance of expression-profiling assays and instrumentation is indeed essential and almost self-evident. As described by Cronin et al. (2), approvals for new drugs or diagnostic tests using RNA profiling data as part of the data-submission process will be hampered unless acceptable and comparable reference materials are established for array- and QRT-PCR-derived data sets. As part of any performance evaluation effort, it is essential to identify and characterize control RNA reference materials that will be used by all RNA-profiling assay systems. The characteristics of both types of RNA reference materials were well described, and their utility was justified by the meeting attendees. However, the goal of the workshop to focus only on the RNA reference materials is troubling and leaves one with the same kind of unrealistic sense that filled me on the stairs with my colleague. Although the report clearly indicates that there are operational and contextual issues in the use of these reference materials, these challenges are viewed as separable from the purpose and the description of these reagents. Acknowledgments by the authors that there are troubling issues associated with the application of the proposed RNA reference materials does not help in achieving the goal of identifying measurable parameters by which expression-profiling assay systems can be evaluated. In fact, it may well be that these efforts will need to be revisited when some of these issues are eventually addressed.&lt;br /&gt;&lt;br /&gt;Deferring the acknowledged issues catalogued by the authors jeopardizes the meeting’s efforts at identifying and using the characterized universal RNA reference materials, and this strategy seems to miss the integrated circumstances in which these materials will be used. Consider, for example, the combination of two deferred issues: not defining the biological background in which the standard RNA samples are to be tested and the desire to correlate results derived from cDNA- and oligonucleotide-based arrays. Testing of each the 96 and 12 suggested RNA transcripts comprising the Assay Process and Array Hybridization reference materials, respectively, is recommended to occur initially in a low-complexity hybridization background. Results from such an approach may well provide a misleading conclusion concerning the performance of any array system. Because the overwhelming majority of mRNAs to be monitored in a biological context are present at low copy numbers per cell (3), the capability of measuring the performance of an array system in the context of the competing related background sequences is integral.&lt;br /&gt;&lt;br /&gt;An oligonucleotide array system tested in a low-complexity hybridization context with the RNA transcripts chosen for the Assay Process reference materials may be evaluated as being highly specific but less sensitive than a cDNA-based array system. However, in the context of a complex hybridization setting, lower specificity in a cDNA array system may lead to similar overall sensitivities for both the cDNA and oligonucleotide array systems. Thus, if initial testing and evaluation of expression-profiling systems is carried out in low-complexity hybridization conditions, performance results and impressions may well be misleading. Altering these impressions, if they are shown to be different in complex hybridization conditions, could be difficult and time-consuming. The identifications of specific RNA transcripts chosen as part of the Assay Process reference materials may themselves need to be reevaluated when used in a complex hybridization setting. Certain RNA transcripts may not be suitable to serve as low-copy-number reference standards because of the competitive-sequence-related transcripts present in a complex hybridization reaction. As one example indicating that membership of the RNA reference materials should be considered in the context of a complex hybridization setting is the observation that the number of pseudogenes in the human genome is now estimated to be nearly 20 000 (4).&lt;br /&gt;&lt;br /&gt;The effect of deferring a solution to this single issue of hybridization complexity in which the RNA reference materials are to be used extends into other issues that will influence how the performance of any array- or QRT-RCR-based technology will be evaluated. The authors report in detail several issues related to the application of the recommended RNA reference materials (2). Among these is the issue of common algorithms or platform-modified algorithms used to calculate the detection and quantification of the proposed RNA reference materials. For the probes in both cDNA and oligonucleotide arrays, there is a quantitative relationship for each probe between true signal and concentration of the target. However, probe-sequence-specific behavior often clouds this relationship. The goal of all algorithms used by expression-profiling systems is to determine which probes are detecting the intended target in the sample mixture as opposed to sequence-related background and, in doing so, to provide the relative amount of detected target in one sample compared with another. Such algorithms may be dependent on estimating the probe-specific behavior. This estimation is based on the signal generated by the probe when there is no target in the sample and also when a range of target concentrations are present. In this latter case, the linearity of the relationship between the signal and the target concentration can be determined for each probe or collection of probes. In the absence of complex hybridization conditions, the value of RNA reference materials to help guide these estimations is dramatically reduced.&lt;br /&gt;&lt;br /&gt;These issues have not gone entirely unattended. Recently, a collection of representatives from 20 different international academic, commercial, and governmental institutions, including NIST, have begun addressing this complex topic. This External RNA Control Consortium met in December 2003 to begin to explore the use of RNA controls in the context of the full complexity of expression-profiling experiments (5).&lt;br /&gt;&lt;br /&gt;The interrelationships and dependencies of the issues summarized by Cronin et al. (2) for the proposed RNA reference materials are considerable. Focusing only on the characteristics of the RNA reference materials gives the impression that this is a way to begin to compartmentalize and simplify the standardization of elements to be used in the technologies used to measure expression profiling. Whitehead et al. (6) once said, “Seek simplicity and distrust it”. Deferring the challenges that are so closely interconnected with the use of the proposed universal RNA reference materials seems an ill-considered start and may create the illusion of progress on this important and complex topic.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8889164823370198399?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8889164823370198399'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8889164823370198399'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/rna-reference-materials-for-gene.html' title='RNA Reference Materials for Gene Expression Studies'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7915149193418054319</id><published>2012-01-01T09:18:00.000-08:00</published><updated>2012-01-01T09:19:19.110-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood'/><title type='text'>Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Blood samples were collected from 1014 patients at 13 US clinic locations before they underwent an invasive prenatal procedure. All samples were processed to plasma, and the DNA extracted from 119 samples underwent massively parallel DNA sequencing. Fifty-three sequenced samples came from women with an abnormal fetal karyotype. To minimize the intra- and interrun sequencing variation, we developed an optimized algorithm by using normalized chromosome values (NCVs) from the sequencing data on a training set of 71 samples with 26 abnormal karyotypes. The classification process was then evaluated on an independent test set of 48 samples with 27 abnormal karyotypes.&lt;br /&gt;&lt;br /&gt;RESULTS: Mapped sites for chromosomes of interest in the sequencing data from the training set were normalized individually by calculating the ratio of the number of sites on the specified chromosome to the number of sites observed on an optimized normalizing chromosome (or chromosome set). Threshold values for trisomy or sex chromosome classification were then established for all chromosomes of interest, and a classification schema was defined. Sequencing of the independent test set led to 100% correct classification of T21 (13 of 13) and T18 (8 of 8) samples. Other chromosomal abnormalities were also identified.&lt;br /&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7915149193418054319?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7915149193418054319'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7915149193418054319'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/fetal-chromosomal-abnormalities-by.html' title='Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-3801050489506706637</id><published>2012-01-01T09:17:00.001-08:00</published><updated>2012-01-01T09:17:37.533-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='detection of aneuploidy'/><title type='text'>detection of aneuploidy</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;To test whether methylation-sensitive amplification and microarray analysis could be used to detect aneuploidy in mixed DNA samples, we performed experiments with artificial mixtures of TB and PB DNA with the intention of simulating the type of mixed sample that might actually be obtained from the plasma of a pregnant woman. DNA from 3 trisomic first-trimester TB samples (1 with trisomy 21 and 2 with trisomy 18) was each mixed with DNA prepared from the PB of a healthy female in a 1:9 ratio. Similarly, for each of these 3 DNA mixtures, we prepared a second mixture of first-trimester TB DNA from a chromosomally normal pregnancy of the opposite sex and female PB DNA in a 1:9 ratio. Thus, in both mixtures the DNA content was 90% from the PB sample and 10% from the TB sample. We then used the protocol described above to prepare methylation-sensitive representations from the mixtures. In each case, the total amount of starting DNA was 10 ng, with 1 ng being derived from the TB sample. Each mixture containing trisomic TB DNA was then compared with a mixture containing euploid TB DNA by hybridizing to the microarray described above.&lt;br /&gt;&lt;br /&gt;For this analysis, we used a standard Qspline normalization procedure without color reversal. The signal associated with each chromosome was summarized by summing the number of array addresses either above or below a cutoff M value and calculating the ratio of the 2 sums. We then assessed these chromosome-specific ratios by computing a T score as described above. With this method, it was possible to detect the chromosome with known trisomy with a high degree of confidence. In practice, the best discrimination occurred when the analysis was based on approximately 10% of the data with the highest or lowest signal ratios (Fig. 4⇓ , black columns). These results show that aneuploidy can be confidently detected, despite the use of samples consisting of only 10 ng of total DNA, of which the trisomic component was only 10%. In all 3 cases, the X-chromosome difference stood out even more clearly than the autosomal trisomy.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-3801050489506706637?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3801050489506706637'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3801050489506706637'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/detection-of-aneuploidy.html' title='detection of aneuploidy'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-2141357996370754009</id><published>2012-01-01T09:16:00.001-08:00</published><updated>2012-01-01T09:16:28.961-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='dna amplification Result'/><title type='text'>dna amplification Result</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: verdana;"&gt;we designed the amplification linker to ligate to the overhang left by HpyCh4IV digestion and simultaneously to create a site for the relatively rare–cutting enzyme, MluI. When amplification occurs as intended with the linkers ligated to HpyCh4IV sites, subsequent MluI digestion of products cleaves off the linker sequence. Because PCR is performed with a biotinylated primer, products can be bound to streptavidin-coated paramagnetic beads. In cases of illegitimate amplification, the fragment cannot be released from the paramagnetic beads by MluI digestion. In practice, this method was highly successful in reducing the proportion of nonspecific amplification products, as was shown by both sequencing of random PCR products and restriction digests of PCR products that had been subjected to a second round of amplification&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;Microarray analysis generally requires labeling of microgram quantities of DNA; however, the DNA yield from a linker-mediated PCR performed on only 1–10 ng of starting material is generally no greater than approximately 200 ng. To address the need for more DNA, we performed a second round of amplification with isothermal MSD, a procedure that provides an enormous degree of amplification while introducing little bias(7); however, MSD amplification has a strong preference for high molecular weight templates(8). To address this issue, we exploited the fact that after the process described above was completed, all PCR fragments had MluI sites at both ends. Self-ligation with T4 DNA ligase produced efficient polymerization of the low molecular weight fragments into higher molecular weight fragments that could be efficiently amplified via MSD&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-2141357996370754009?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2141357996370754009'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2141357996370754009'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/dna-amplification-result.html' title='dna amplification Result'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6070439534631752583</id><published>2012-01-01T09:14:00.001-08:00</published><updated>2012-01-01T09:14:31.672-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='dna amplification'/><title type='text'>dna amplification</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: courier new;"&gt;Amplified representations of genomic DNA samples were prepared according to the scheme depicted in Fig. 1⇓ . DNA was first digested with the methylation-sensitive restriction enzyme, HpyCh4IV (New England Biolabs). After digestion, linker/adapters were ligated, and the PCR was performed with a linker primer. The linker sequence (CTAGGAGCTGGCAGATCGTACATTGACG) and PCR conditions were adapted as previously described(2). As shown in Fig. 1⇓ , the linker was designed so that when it ligated to the overhang created by HpyCh4IV digestion, it created a site for the relatively rare–cutting restriction enzyme, MluI (New England Biolabs). After linker ligation, the PCR was performed for 18 cycles. PCR products were then bound to streptavidin-coated paramagnetic beads (Promega), and the bound DNA was released from the beads by MluI digestion. The resulting DNA fragments were self-ligated by the addition of T4 DNA ligase (New England Biolabs) and then amplified with a commercial multiple strand displacement (MSD) amplification kit (illustra GenomiPhi V2 DNA Amplification Kit; GE Healthcare Life Sciences) according to the manufacturer’s instructions. &lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6070439534631752583?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6070439534631752583'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6070439534631752583'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/dna-amplification.html' title='dna amplification'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-5815025998479162898</id><published>2012-01-01T09:12:00.000-08:00</published><updated>2012-01-01T09:13:08.464-08:00</updated><title type='text'>What types of treatment decisions are based on KRAS status</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Trial data showed that no colorectal carcinoma patient with an activating KRAS mutation has responded to treatment with anti-EGFR antibodies. Carcinomas from patients unresponsive to first-line therapy can be screened retrospectively for the presence of the activating KRAS point mutations in codons 12, 13, and 61 by use of DNA template extracted from paraffin blocks.&lt;br /&gt;&lt;br /&gt;Wild-type KRAS is necessary but not sufficient for response to EGFR inhibitors in patients with metastatic colorectal cancer. In addition, it has been shown that mutated KRAS [and BRAF (v-raf murine sarcoma viral oncogene homolog B1)] is associated with poorer overall survival. Since approximately 40% of tumor specimens in patients with colorectal cancer will exhibit KRAS mutations, KRAS mutation analysis is critical when considering anti-EGFR therapy. Patients with tumors exhibiting KRAS mutations should be considered for other treatments. Unfortunately, this does limit therapeutic options, but clinical trials are now open that specifically address patients with KRAS-mutated tumors.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-5815025998479162898?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5815025998479162898'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5815025998479162898'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/what-types-of-treatment-decisions-are.html' title='What types of treatment decisions are based on KRAS status'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6914870644005324719</id><published>2012-01-01T09:11:00.001-08:00</published><updated>2012-01-01T09:11:31.772-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='DNA Chips for the Clinical Laboratory'/><title type='text'>DNA Chips for the Clinical Laboratory</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;For the sake of accuracy, I want to update the readership on the most current information about the technology we have developed; some of this information may not have been available to Dr. McGlennen during the research for his review. Clinical Micro Sensors, Inc. (CMS; Pasadena, CA) was acquired by Motorola in June 2000 and is now part of Motorola Life Sciences. Dr. McGlennen’s paragraph on CMS (Motorola) focused on our ultimate vision of a point-of-care instrument for molecular diagnostics. Our vision is to integrate nucleic acid amplification and, ultimately, specimen preparation and to provide wireless communication of results to a laboratory information system, pharmacy, or physician along with transaction support and other features. For the near term, we have developed enabling technology for the clinical molecular diagnostics laboratory that exploits postamplification bioelectronic detection of nucleic acids (DNA or RNA targets) via hybridization to oligonucleotide capture probes on gold electrode arrays affixed to printed circuit boards or chips&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6914870644005324719?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6914870644005324719'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6914870644005324719'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/dna-chips-for-clinical-laboratory.html' title='DNA Chips for the Clinical Laboratory'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-4689342960815091105</id><published>2012-01-01T09:08:00.002-08:00</published><updated>2012-01-01T09:10:02.328-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Vesicle-Skin Interaction Study by Fluorescence Microscopy'/><title type='text'>Vesicle-Skin Interaction Study by Fluorescence Microscopy</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Vesicle-Skin Interaction Study by Fluorescence Microscopy&lt;br /&gt;&lt;br /&gt;Fluorescence microscopy was carried according to the protocol used for TEM and SEM study. Paraffin blocks are used, were made, 5-µm thick sections were cut using microtome (Erma optical works, Tokyo, Japan) and examined under a fluorescence micro Cytotoxicity Assay  MT-2 cells (T-lymphoid cell lines) were propagated in Dulbecco's modified Eagle medium (HIMEDIA, Mumbai, India) containing 10% fetal calf serum, 100 U/mL penicillin, 100 mg/mL streptomycin, and 2 mmol/L L-glutamine at 37°C under a 5% CO2 atmosphere. Cytotoxicity was expressed as the cytotoxic dose 50 (CD50) that induced a 50% reduction of absorbance at 540 nm. &lt;br /&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-4689342960815091105?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4689342960815091105'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4689342960815091105'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/vesicle-skin-interaction-study-by.html' title='Vesicle-Skin Interaction Study by Fluorescence Microscopy'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-9070558399548515760</id><published>2012-01-01T09:08:00.001-08:00</published><updated>2012-01-01T09:08:37.785-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Filter Membrane-Vesicle Interaction Study by Scanning Electron Microscopy'/><title type='text'>Filter Membrane-Vesicle Interaction Study by Scanning Electron Microscopy</title><content type='html'>&lt;div style="text-align: justify; font-weight: bold;"&gt;&lt;br /&gt;&lt;/div&gt;&lt;div style="font-family: verdana; text-align: justify;"&gt;&lt;br /&gt;&lt;span style="font-weight: bold;"&gt;Vesicle suspension (0.2 mL) was applied to filter membrane having a pore size of 50 nm and placed in diffusion cells. The upper side of the filter was exposed to the air,  whereas the lower side was in contact with PBS (phosphate buffer saline solution), (pH 6.5). The filters were removed after 1 hour and prepared for SEM studies by fixation at 4°C in Karnovsky’s fixative overnight followed by dehydration with graded ethanol solutions (30%, 50%, 70%,90%, 95%, and 100% vol/vol in water).&lt;/span&gt;&lt;br /&gt;&lt;span style="font-weight: bold;"&gt;Finally, filters were coated with gold and examined in SEM (Leica, Bensheim, Germany).  &lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-9070558399548515760?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/9070558399548515760'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/9070558399548515760'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/filter-membrane-vesicle-interaction.html' title='Filter Membrane-Vesicle Interaction Study by Scanning Electron Microscopy'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7206565208895252233</id><published>2012-01-01T09:06:00.001-08:00</published><updated>2012-01-01T09:06:58.879-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Advantages of Ethosomes'/><title type='text'>Advantages of Ethosomes</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: verdana; font-weight: bold;"&gt;Advantages of Ethosomes&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-family: verdana; font-weight: bold;"&gt;delivery systems:  &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;&lt;span style="font-weight: bold;"&gt;1.  Enhanced permeati&lt;/span&gt;on of drug through skin for transdermal drug delivery. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;2.  Delivery of large molecules (peptides, protein molecules) is possible. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;3.  It contains non‐toxic raw material in formulation. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;4.  High patient compliance  ‐ the ethosomal drug is administered in semisolid form (gel or     cream) hence producing high patient compliance. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;5.  The Ethosomal system is passive, non‐invasive and is available for immediate commercialization. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;6.  Ethosomal drug delivery system can be applied widely in Pharmaceutical, Veterinary, Cosmetic fields. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;7.  Simple method for drug delivery in comparison to Iontophoresis and Phonophoresis and other complicated methods.&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7206565208895252233?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7206565208895252233'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7206565208895252233'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2012/01/advantages-of-ethosomes.html' title='Advantages of Ethosomes'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-5141349671877757524</id><published>2011-12-24T08:35:00.000-08:00</published><updated>2011-12-24T08:37:44.437-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='fungi in the synthesis of  nanoparticle'/><title type='text'>fungi in the synthesis of  nanoparticle</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: verdana;"&gt;The use of fungi in the synthesis of nanoparticle is a relatively recent addition to the list of microorganisms. The shift from bacteria to fungi as a means of developing natural “nanofactories” has the added advantage that downstream processing and handling of the biomass would be much simpler. The use of eukaryotes is potentially exiting since they &lt;/span&gt;&lt;span style="font-family: verdana;"&gt;secrete large amount of proteins, thus increasing productivity, and their easy usage in laboratory works is a suitable option in production of metallic nanoparticles among other microorganisms. More over the process can be easily scaled up, economically viable with the possibility of easily covering large surface areas by suitable growth of mycelia. Therefore, the present study has reported the biological process for the synthesis of silver nanoparticles extracellularly using  R.stolonifer.   &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;Rhizopus stolonifer showed maximum absorbance at 422nm. Parametric optimization study showed maximum absorbance at 40&lt;/span&gt;&lt;span style="font-family: verdana;"&gt;C and pH 7.0. Further characterization was made by UV-Visible &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;absorption spectroscopy which shows maximum absorption at 422 nm, Transmission Electron Microscope (TEM) revealed the formation of spherical nanoparticles with size ranging between 5 to 50 nm. Energy Dispersive Spectroscope (EDS) shows the optical absorption peak at 3kev, Fourier Transform Infrared (FT-IR) shows the bands at 1645(1), 1537(2) and 1454(3) cm-1. The biosynthesized silver nanoparticles have broad range of &lt;/span&gt;&lt;span style="font-family: verdana;"&gt;applications such as fluorescent biological labels, drug and gene delivery, bio detection of pathogens, detection of &lt;/span&gt;&lt;span style="font-family: verdana;"&gt;proteins, probing of DNA structure, tissue engineering, tumor destruction via heating, separation and purification of biological molecules and cells, and phagokinetic studies. Majority of the silver nanoparticle applications in medicine are geared towards drug delivery. Therefore, further &lt;/span&gt;&lt;span style="font-family: verdana;"&gt;work will be on antibacterial activity of silver nanoparticles.   &lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-5141349671877757524?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5141349671877757524'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5141349671877757524'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/12/fungi-in-synthesis-of-nanoparticle.html' title='fungi in the synthesis of  nanoparticle'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1456270948106121710</id><published>2011-12-24T08:26:00.000-08:00</published><updated>2011-12-24T08:32:44.510-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='SYNTHESIS AND CHARACTERIZATION OF SILVER NANOPARTICLES  BY RHIZOPUS STOLONIER'/><title type='text'>SYNTHESIS AND CHARACTERIZATION OF SILVER NANOPARTICLES  BY RHIZOPUS STOLONIER</title><content type='html'>&lt;span style="font-family: verdana;"&gt;SYNTHESIS AND CHARACTERIZATION OF SILVER NANOPARTICLES  BY RHIZOPUS STOLONIER&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: verdana;"&gt;Biological synthesis of silver nanoparticles by using fungi is reported here. The present study is on screening of filamentous fungi for the production of silver nanoparticles extracellularly. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;Eight fungi,  Rhizopus.spp, Aspergillus terreus, A.flavus, A.niger, A.clavatus, Acremonium.spp, A.rutilum, Trichoderma.sp. have been screened for the production of silver nanoparticle. The fungal filtrates of the above said isolates were subjected to silver nitrate.  After incubation, visual observation of brown color is an indication of silver nanoparticle production. Of the eight fungi, only one Rhizopus stolonifer showed   maximum absorbance at 422nm. Parametric optimization study showed maximum absorbance at 400 C and pH 7.0. Further characterization was made by UV-Visible absorption spectroscopy which shows maximum absorption at 422 nm, Transmission Electron Microscope (TEM) revealed the formation of spherical nanoparticles with size ranging between 5 to 50 nm. Energy Dispersive Spectroscope (EDS) shows the optical absorption peak at 3kev, Fourier Transform Infrared (FT-IR) shows the bands at 1645(1), 1537(2) and 1454(3) cm-1.&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;UV-Visible absorption spectroscopy is one of the most widely used techniques for structural characterization of silver nanoparticles. In our experiment the maximum absorbance was observed at 422nm, implying that the bioreduction of the silver nitrate has taken place following incubation of the AgNO3  solution in the presence of cell-free extract. Our results are correlating with the reports of Sadowski, et al, (2008) and Maliszwaska, et.al., (2009) with the fungus Penicillium. Surface plasmon peak was located at 420 nm using  klebsiella pneumonia  (Minaeian et al 2008). Mukherjee et al, (2007) reported an intense peak at 410nm. It is reported that the absorption spectrum of spherical silver nanoparticles presents a maximum between 420nm and 450nm  (Maliszewska 2008).  &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;A representative TEM image recorded from drop coated film of a silver nanoparticles are spherical in shape.  All the particles are well separated and no agglomeration was noticed. The size  ranges between 5nm to30 nm was seen. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;The process of growing silver nanoparticles comprises of two key steps: &lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;(a) bioreduction of AgNO3 to produced &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;silver nanoparticles and &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;(b) stabilization and/or encapsulation of the same by &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt;suitable capping agents 11. It is suggest that the biological molecules could possibly perform the function for the stabilization of the AgNPs. EDS analysis gives the additional evidence for the reduction of silver nanoparticles to elemental silver. The optical absorption peak is observed approximately at 3kev, which is typical for the absorption of  metallic silver nanocrystals due to surface plasmon resonsnce, which confirms the presence of nanocrystalline elemental  silver. Spectrum shows strong silver signal along with weak oxygen and carbon peak, which may be originate from the  biomolecules that are bound to the surface of nanosilver particles. &lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1456270948106121710?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1456270948106121710'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1456270948106121710'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/12/synthesis-and-characterization-of.html' title='SYNTHESIS AND CHARACTERIZATION OF SILVER NANOPARTICLES  BY RHIZOPUS STOLONIER'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-5369692547289433960</id><published>2011-12-24T08:24:00.000-08:00</published><updated>2011-12-24T08:25:24.587-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Ocular Inserts; Eye Infection; ophthalmic inserts'/><title type='text'>Ocular Inserts; Eye Infection; ophthalmic inserts</title><content type='html'>Abstract&lt;br /&gt;&lt;br /&gt;Ocular drug delivery is one of the most fascinating and challenging tasks facing the Pharmaceutical researchers. One of the major barriers of ocular medication is to obtain and maintain a therapeutic level at the site of action for prolonged period of time. The eye as a portal for drug delivery is generally used for local therapy against systemic therapy to avoid the risk of eye damage from high blood concentration of the drug, which is not intended.&lt;br /&gt;&lt;br /&gt;Keywords&lt;br /&gt;&lt;br /&gt;Ocular Inserts; Eye Infection; ophthalmic inserts&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-5369692547289433960?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5369692547289433960'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5369692547289433960'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/12/ocular-inserts-eye-infection-ophthalmic.html' title='Ocular Inserts; Eye Infection; ophthalmic inserts'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6255624593149185524</id><published>2011-12-24T08:23:00.000-08:00</published><updated>2011-12-24T08:24:39.672-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Ethosomes; Transdermal drug delivery; Ethosomal encapsulation; Ethosomes effects'/><title type='text'>Ethosomes; Transdermal drug delivery; Ethosomal encapsulation; Ethosomes effects</title><content type='html'>&lt;span style="font-family: courier new;"&gt;Ethosomes; Transdermal drug delivery; Ethosomal encapsulation; Ethosomes effects&lt;/span&gt;&lt;br /&gt;&lt;br /&gt;&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: verdana;"&gt;Ethosomes are soft, malleable vesicles and potential carrier for transportation of drugs. Ethosomes are characterized by simplicity in their preparation, safety and efficacy and can be tailored for enhanced skin permeation of active drugs. Ethosomes have been found to be much more efficient at delivering drug to the skin, than either liposomes or hydro alcoholic solution. Ethosomes have been tested to encapsulate hydrophilic drugs, cationic drugs, proteins and peptides. Ethosomal carrier opens new challenges and opportunities for the development of novel improved therapies.&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;br /&gt;&lt;span style="font-family: verdana; font-weight: bold;"&gt;Keywords&lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: courier new;"&gt;Ethosomes; Transdermal drug delivery; Ethosomal encapsulation; Ethosomes effects&lt;/span&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6255624593149185524?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6255624593149185524'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6255624593149185524'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/12/ethosomes-transdermal-drug-delivery.html' title='Ethosomes; Transdermal drug delivery; Ethosomal encapsulation; Ethosomes effects'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7419171018650778201</id><published>2011-12-24T08:20:00.000-08:00</published><updated>2011-12-24T08:23:15.094-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Sesbania grandiflora; Phytochemical constituents; Acute toxicity'/><title type='text'>PHYTOCHEMICAL AND PRELIMINARY TOXICITY STUDY OF SESBANIA GRANDIFLORA (LINN.) FLOWERS</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Sesbania grandiflora Linn. (Family : Fabaceae) is widespread distributed  West Bengal, Assam, Karnataka and North-Eastern. The present study  intended with various phytochemical  screening  and toxicity studies were carried out on the flowers of Sesbania grandiflora. Preliminary phytochemical evalution of the methanolic and aqueous extracts of revealed that presence of  corbohydrate, proteins, amino acids, saponins, flavonoids, alkaloids, tannins and glycosides.The acute toxicity study were performed to determined LD50 ­ of 99% methanolic extract 20-40 mg/kg, 70% methanolic extract100-200 mg/kg and aqueous extract250-500 mg/kg.&lt;br /&gt;&lt;br /&gt;Pandey Govind, Hepatogenic effect of some indigenous drugs on experimental liver damage. Phd thesis. Jabalpur, MP, India: JNKVV;1990&lt;br /&gt;&lt;br /&gt;Kirthikar KR, Basu BD. Indian Medicinal plants Vol III. Dehradun: Bishen Singh Mahendra Pal Singh 1998: 735-36.&lt;br /&gt;&lt;br /&gt;Das KC, Tripati AK.A new flavanol glycoside from Sesbania grandiflora (Linn.). Fitoterapia 1998; 69(5): 477-8&lt;br /&gt;&lt;br /&gt;Asima Chatterjee, Satyesh Chandra Pakrashi. The Treatise on Indian Medicinal Plants Vol II. New Delhi: Publication and Information Directorate; 1992: 118&lt;br /&gt;&lt;br /&gt;Mukherjee Pulok. k , “ Quality control of herbal drugs ”Business Horizons , 3-4, 2008&lt;br /&gt;&lt;br /&gt;Jayaraman J. “Laboratory Manual in Biotechemistry. Published by birla publication New Delhi (I): 50-53, 1995.&lt;br /&gt;&lt;br /&gt;Kar Ashutosh. “Pharmacognosy and Pharmabiotechnology.” Published by new age international, New Delhi (II): 147, 2007.&lt;br /&gt;&lt;br /&gt;Singh S.P. “Practical Manual of Biochemistry.” (V) Published by CBS publishers &amp;amp; distributors New Delhi: 17-31, 2004.&lt;br /&gt;&lt;br /&gt;Kokate CK, Ed. Practical Pharmacognosy. 4th ed. New Delhi: Vallabha Prakashan; 1999: 149-56.&lt;br /&gt;&lt;br /&gt;Khandelwal KR. Practical Pharmacognosy techniques and experiments. 2nd ed. Pune: Nirali Prakashan; 2000: 149-56.&lt;br /&gt;&lt;br /&gt;Mrs. Prema Veeraraghavan. Expert consultant, CPCSEA, OECD guideline No. 420.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7419171018650778201?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7419171018650778201'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7419171018650778201'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/12/phytochemical-and-preliminary-toxicity.html' title='PHYTOCHEMICAL AND PRELIMINARY TOXICITY STUDY OF SESBANIA GRANDIFLORA (LINN.) FLOWERS'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1706695751084354807</id><published>2011-11-26T07:43:00.003-08:00</published><updated>2011-11-26T07:43:44.418-08:00</updated><title type='text'>Forensic anthropology  In Uk, US</title><content type='html'>Forensic anthropology is the application of the science of physical anthropology and human osteology (the study of the human skeleton) in a legal setting, most often in criminal cases where the victim's remains are in the advanced stages of decomposition. A forensic anthropologist can also assist in the identification of deceased individuals whose remains are decomposed, burned, mutilated or otherwise unrecognizable. The adjective "Forensic" refers to the application of this subfield of science to a court of law.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1706695751084354807?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1706695751084354807'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1706695751084354807'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/11/forensic-anthropology-in-uk-us.html' title='Forensic anthropology  In Uk, US'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-4311704772649955858</id><published>2011-11-26T07:43:00.001-08:00</published><updated>2011-11-26T07:43:19.097-08:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Forensic botany'/><title type='text'>Forensic botany</title><content type='html'>Forensic botany &lt;br /&gt;&lt;br /&gt;Forensic botanists look to plant life in order to gain information regarding possible crimes. Leaves, seeds and pollen found either on a body or at the scene of a crime can offer valuable information regarding the timescales of a crime and also if the body has been moved between two or more different locations. Forensic study of pollen is known as forensic palynologyand can often be very specific about location and time of year.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-4311704772649955858?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4311704772649955858'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4311704772649955858'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/11/forensic-botany.html' title='Forensic botany'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-3826579429785341837</id><published>2011-11-26T07:42:00.003-08:00</published><updated>2011-11-26T07:42:49.089-08:00</updated><title type='text'>Forensic odontology in UK London</title><content type='html'>Odontologists or dentists can be used in order to aid in an identification of degraded remains. Remains that have been buried for a long period or which have undergone fire damage often contain few clues to the identity of the individual. Tooth enamel as the hardest substance in the human body often endures and as such odontologists can in some circumstances compare recovered remains to dental records.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-3826579429785341837?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3826579429785341837'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3826579429785341837'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/11/forensic-odontology-in-uk-london.html' title='Forensic odontology in UK London'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8100056069643502688</id><published>2011-11-26T07:42:00.001-08:00</published><updated>2011-11-26T07:42:24.078-08:00</updated><title type='text'>DNA based techniques</title><content type='html'>DNA based evidence is perhaps one of the strongest linking tools that law enforcement investigators have at their disposal. DNA evidence can definitively link a suspect to either acrime scene or victim. Nuclear DNA evidence has been recovered from blood, semen, saliva, skin cells and hair. Furthermore Mitochondrial DNA can be recovered from both bone andteeth dating back thousands of years. Laboratory analysis of DNA evidence generally involves the sample being amplified and quantified by a form of the Polymerase chain reactionknown as Quantitative PCR or qPCR. (PCR) amplification of any sample recovered followed by sequencing via Capillary electrophoresis in order to obtain a DNA profile which can be compared to suspect DNA.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8100056069643502688?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8100056069643502688'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8100056069643502688'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/11/dna-based-techniques.html' title='DNA based techniques'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8577426499008402201</id><published>2011-10-10T10:29:00.000-07:00</published><updated>2011-10-10T10:31:23.641-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Alternative splicing of mRNA from a single genetic locus'/><title type='text'>Alternative splicing of mRNA from a single genetic locus</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;&lt;div style="text-align: center;"&gt;&lt;span style="font-weight: bold;font-size:180%;" &gt;Alternative splicing of mRNA from a single genetic locus &lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;br /&gt; Alternative splicing refers to variation in the way that transcripts from a sin- gle genetic locus are processed posttranscriptional. This phenomenon, now widely known in eukaryotic cells, was virtually unheard of 20 years ago. Understanding that higher plant and animal cells can differentially process a particular species of pre-mRNA molecules goes a long way toward explaining how a cell with approximately 20,000 different genes can encode significantly greater numbers of transcripts which, in turn, may be able to encode several hundred thousand (or more) proteins. By joining together various combinations of exons and even changing the functionality of introns, a remarkable diversity of proteins may result from a seeming economy of genomic sequences. Upon completion of the human genome project, the apparent paucity of genes came as a great surprise, given the complexity of the proteome. In the context of alternative transcript processing and posttranslational modification of proteins, the known number of genes in most species is not inconsistent with the biochemical complexity of the cell. The more common strategies used by cells to accomplish alternative splicing are known as exon skipping, intron retention, the manifestation of cryptic introns, and nonsense-mediated mRNA decay. These phenomena can occur within a single cell in response to the environmental stimuli or may occur in a tissue-specific manner in order to support the physiology of the organism. Details pertaining to these fascinating posttranscriptional phenomena were recently reviewed ( Louzada, 2007 ). It is important to understand that alternative processing of transcripts may also involve modulating the addition of the poly(A) tail associated with the transcripts ’ 3 end through the use of alternative polyadenylation sites. Such poly(A) variants may well influence the stability of the transcript in the cell as well as the precise combination of exons which are manifested in the mature mRNA.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8577426499008402201?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8577426499008402201'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8577426499008402201'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/alternative-splicing-of-mrna-from_10.html' title='Alternative splicing of mRNA from a single genetic locus'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-255028537229569195</id><published>2011-10-10T10:28:00.000-07:00</published><updated>2011-10-10T10:29:35.583-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='mRNA stability'/><category scheme='http://www.blogger.com/atom/ns#' term='and turnover'/><category scheme='http://www.blogger.com/atom/ns#' term='transport'/><title type='text'>mRNA stability, transport, and turnover</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;&lt;div style="text-align: center;"&gt;&lt;span style="font-weight: bold;font-size:180%;" &gt;mRNA stability, transport, and turnover&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;br /&gt;&lt;br /&gt; A fundamental regulator of gene expression in all cell types and in all subcellu-lar compartments is the stability of translatable transcripts. In general, mRNAs do not have long half-lives, presumably so as to prevent the over-production of a normal protein which could, in turn, disrupt homeostasis and give rise to a disease state. At the same time, mRNAs must remain stable long enough to become recognized and engaged by the translation apparatus, which are the intrinsic functions of the 5 cap. If large quantities of a protein are to be produced in a cell, one may expect that the corresponding gene will be tran-scribed with a greater frequency than other genes with, for example, house-keeping functions. Similarly, the formation of mRNA secondary structures close to the 5 end in both plants animals can severely limit the scanning of the mRNA such that the initiation of translation is all but inhibited ( Pain, 1996 ; Kozak, 1991 ; Dinesh-Kumar and Miller, 1993 ; Futterer and Hohn, 1996 ; for review, see Kozak, 1999 ). At the other end of the molecule, the length of the poly(A) tail itself plays a role in mRNA stability, as shortening of the poly(A) tail results in destabiliza-tion of cytoplasmic transcripts ( Decker and Parker, 1994 ; Beelman and Parker, 1995 ). Early studies demonstrated that the enzymatic removal of the poly(A) tract from globin mRNA results in a rapid loss of translatability in frog oocytes due to rapid degradation ( Huez et al ., 1974 ; Marbaix et al ., 1975 ). More recent studies have demonstrated the role of the 3 AREs; deletion of these sequences greatly reduces the rate of deadenylation, thereby prolonging mRNA in the cytoplasm ( Wilson and Treisman, 1988 ; Shyu et al ., 1991 ; Decker and Parker, 1993 ; Chen and Shyu, 1994 ). Further, an increasing body of evidence is suggesting that both the length and nucleotide composition of the 5 UTR and 3 UTR play a previously unrecognized role in the stability of the tran-script (reviewed by Lewin, 2008 ). Finally, another recently discovered pathway known as nonsense-mediated mRNA decay appears to be at work in eukaryotic cells which rapidly targets for degradation mRNAs.&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-255028537229569195?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/255028537229569195'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/255028537229569195'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/mrna-stability-transport-and-turnover.html' title='mRNA stability, transport, and turnover'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-5457237255922033496</id><published>2011-10-10T10:26:00.000-07:00</published><updated>2011-10-10T10:28:03.320-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Messenger RNA'/><title type='text'>Messenger RNA</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;  A     great many genes are transcribed constitutively by RNA polymerase II   13  , and it is clear that large quantities of heterogeneous nuclear RNA (hnRNA) are turned over in the nucleus.In eukaryotic cells, messenger RNAs (mRNA) are derived from precursor hnRNA through a series of modifying reactions, which include formation of the 5    cap, methylation, splicing, 3 end processing, and frequently, polyadenylation. Only 1  –  3% of the total RNA in the cytoplasm of a typical eukaryotic cell is mature mRNA. RNA is produced at different rates from different loci; therefore, each mRNA species is classified based on its cytoplasmic prevalence or, more properly, its abundance. There are three official such categories, high abundance, medium abundance, and low abundance mRNAs and, in the mind of this Author, the unofficial   very low   abundance category.&lt;br /&gt; Highly   abundant transcripts are present in hundreds of copies per cell. These are most often observed when a cell is producing an enormous quantity of a particular protein or is high specialized or   differentiated   to perform a unique function. Medium abundance transcripts are best thought of as being present in dozens of copies per cell; many genes with housekeeping   14   functions manifest their mRNAs at this level of prevalence in the cell. Low abundance mRNAs are generally prevalent in 10 or fewer copies per cell and often are difficult to assay&lt;br /&gt;by many of the older classical techniques, such as Northern analysis , without some form of enrichment in order to increase the statistical probability that such rare messages will be detectable.   Very low   bundance mRNAs are those present in fewer than one copy per cell, a designation which generally is generally associated with heterogeneous tissue samples or, very commonly, in cases where cancer cells growin in culture manifest a variable, heterogeneous karyotype. In the past these types of mRNAs were referred to as the   “ hard to clone genes  ”  , though newer methods.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-5457237255922033496?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5457237255922033496'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5457237255922033496'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/messenger-rna.html' title='Messenger RNA'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7095924915678281309</id><published>2011-10-04T09:42:00.000-07:00</published><updated>2011-10-04T09:43:43.432-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='DNA– Protein  Interactions'/><title type='text'>DNA– Protein  Interactions</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;The first DNA-binding proteins studied by scientists were regu-latory proteins from bacteria, where they act to control perhaps thesimplest genetic systems found in Nature. Many of these bacterialproteins act as ‘repressors’ of gene activity (see the upper part of thepicture) if they bind tightly to a base-sequence of DNAwhich over-laps the ‘promoter’ sequence, where an RNA polymerase enzymecan also bind. They can thereby prevent the binding of RNA poly-merase to a particular promoter, through direct competition for thesame local segment of DNA. In general, such repressor proteinsreduce the rate at which RNAis made from a promoter; and indeedsuch repression of RNA synthesis may be specific to just one or afew genes in an entire organism, if the repressor binds to only oneor a few sites on an entire chromosome.In bacteria, repressor proteins play an important role in reducinglocal rates of transcription; but in plants, animals and other organ-isms whose cells have nuclei – known collectively as eukaryotes1–the chromosome structure itself tends to repress transcription.Indeed, in nucleated organisms it is the activation of genes thatseems to be the more important aspect of gene regulation. Thatprocess is managed by ‘activators’ of transcription  that bind specifically to DNAin the general vicinityof a binding site for RNA polymerase. The activator protein maythen increase the rate at which RNA is made, by directly assistingthe RNA polymerase enzyme and its auxiliary proteins to bind at the promoter sequence, through a network of protein-to-protein contacts; or else indirectly by helping to ‘recruit’ enzymes that canchemically modify the chromatin  For instance, cer-tain transcription activators may direct histone acetylases to thegeneral region of a specific gene. The resulting modification of his-tones may cause the chromatin to decompact near that promoter,and thereby make it more accessible to RNA polymerase and itsauxiliary proteins.‘DNA looping’ may represent a somewhat more complex exam-ple of how genes are regulated in three dimensions, and not just inone or two, by some linear or planar arrangement of DNA bindingsites. In the latter case, two or more repressor or activator proteinsmay bind to the same piece of DNA, and then join together to cre-ate a small loop or coil, which can affect gene activity very strongly(either positively or negatively) on account of its stable structure.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7095924915678281309?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7095924915678281309'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7095924915678281309'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/dna-protein-interactions.html' title='DNA– Protein  Interactions'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1222297259530323806</id><published>2011-10-04T09:40:00.000-07:00</published><updated>2011-10-04T09:41:22.461-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Purification of polysome-engaged mRNA'/><title type='text'>Purification of polysome-engaged mRNA</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;&lt;div style="text-align: center;"&gt;&lt;span style="font-weight: bold;font-size:180%;" &gt;Purification of polysome-engaged mRNA &lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;br /&gt; mRNA is an excellent parameter of gene expression but it is not the only one. Thorough assessment of regulation of this aspect of the cellular biochemistry is multifaceted. Standard RNA isolation techniques, even when coupled to PCR, reveal information about the steady-state abundance of certain RNAs in the cell at the moment of cell lysis, yet reveal nothing at all about the translational fate of the transcripts of experimental interest. Recall that the gene expression is also controlled at the translational and posttranslational levels. Clearer definition of the translational aspect of gene expression may be gained by collecting and analyzing the mRNA fraction that has engaged the translational machinery. The polysome fraction of the cell (all mRNAs engaged by ribosomes) is a fairly accurate indicator of the proportion of the mRNA mass that has actually advanced to the translational level along the gene expression pathway. In the cell, some polysomes are associated with the endo- plasmic reticulum (presumably synthesizing secreted proteins, mitochondrial proteins, and proteins embedded in the membrane) while others remain as free polysomes, which are believed to synthesize proteins that will remain in the cytoplasm or move into the nucleus. Thus, the isolation of polysome-engaged mRNA is used to profile gene expression at the translational level and may well be a more accurate indicator of both efficiency of translation initiation as well as the phenotype identity of the cells under investigation.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1222297259530323806?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1222297259530323806'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1222297259530323806'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/purification-of-polysome-engaged-mrna.html' title='Purification of polysome-engaged mRNA'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-592521870921911917</id><published>2011-10-04T09:38:00.000-07:00</published><updated>2011-10-04T09:40:06.735-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Trans -splicing: mRNA repair'/><title type='text'>Trans-splicing: mRNA repair</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt; An overwhelming majority of higher plant and animal (eukaryotic) genes  consist  of coding regions known as exons that are separated by intervening, non-coding  regions known as introns. In the course of gene expression, transcription  results  in the synthesis of a large, immature pre-mRNA molecules, consisting of both  coding (exon) and non-coding (intron) sequences from a specific gene locus. The  process of mRNA maturation involves the removal of introns and the joining  together (ligation) of exons so that all of the coding information is  contiguous.  Generically known as splicing, these well-orchestrated events involve the forma- tion of a spliceosome, i.e. an RNA splicing complex, and involves the removal  of introns and the ligation of exons from the same RNA molecule.  Nearly all of the splicing that occurs in the cell, as described above, is known  as cis -splicing because the exons from a single pre-mRNA molecule are ligated  together. In contrast, trans -splicing involves the joining of exons from two  different RNA molecules, resulting in the formation of a hybrid (chimeric)  RNA molecule. Like cis -splicing, trans -splicing is a naturally occurring proc- ess in eukaryotes, albeit at a much, much lower frequency, though it has been  reported that as many of 70% of all mRNAs in the nematode C. elegans may  be subject to trans- splicing (reviewed by Hastings, 2005 ).  Trans - splicing has the potential to be adapted both in vitro and in vivo to  produce an astonishing array of designer proteins, not to mention potential to  repair defective mRNAs. SMaRT (spliceosome-mediated RNA trans -splicing)  technology, a patented spliceosome-mediated trans- splicing process owned by  VIRxSYS, attempts to correct cellular damage caused by the formation of aber-  rant proteins by fixing or “ reprogramming ” defective pre-mRNA molecules so  that only normal proteins are produced, even when a mutation is harbored and  persists in the DNA. Naturally occurring transcription produces.&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-592521870921911917?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/592521870921911917'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/592521870921911917'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/trans-splicing-mrna-repair.html' title='Trans-splicing: mRNA repair'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1871643035661896959</id><published>2011-10-04T09:35:00.000-07:00</published><updated>2011-10-04T09:36:49.132-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Alternative splicing of mRNA from a single genetic locus'/><title type='text'>Alternative splicing of mRNA from a single genetic locus</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt; Alternative splicing refers to variation in the way that transcripts from a sin- gle genetic locus are processed posttranscriptionally. This phenomenon, now widely known in eukaryotic cells, was virtually unheard of 20 years ago. Understanding that higher plant and animal cells can differentially process a particular species of pre-mRNA molecules goes a long way toward explaining how a cell with approximately 20,000 different genes can encode significantly greater numbers of transcripts which, in turn, may be able to encode several hundred thousand (or more) proteins. By joining together various combinations of exons and even changing the functionality of introns, a remarkable diversity of proteins may result from a seeming economy of genomic sequences. Upon completion of the human genome project, the apparent paucity of genes came as a great surprise, given the complexity of the proteome. In the context of alternative transcript processing and posttranslational modification of proteins, the known number of genes in most species is not inconsistent with the biochemical complexity of the cell.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1871643035661896959?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1871643035661896959'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1871643035661896959'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/alternative-splicing-of-mrna-from.html' title='Alternative splicing of mRNA from a single genetic locus'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-613133630909223950</id><published>2011-10-04T09:34:00.000-07:00</published><updated>2011-10-04T09:35:22.970-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Bicistronic mRNAs'/><title type='text'>Bicistronic mRNAs</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Although the one mRNA, one polypeptide relationship is widespread among eukaryotes, bicistronic mRNAs have been identified in certain organisms. A bicistronic mRNA is capable of directing the synthesis of two different pro- teins. One might think of biscistronic mRNAs as the eukaryotic answer to the polycistronic mRNAs that are nearly universally observed among prokaryotes. Taking this a step further, functional tricistronic mRNAs, encoding three dif- ferent polypeptides, are in use in certain in vitro applications. Due to the pecu- liarities associated with translation in eukaryotes, the first (upstream) encoded protein is synthesized in the 5 -cap dependent manner usually associated with translation of monocistronic mRNAs while initiation of the synthesis of the second (downstream) polypeptide is under the control by an internal ribos- ome entry site (IRES) which allows ribosome assembly in a non-cap-dependent manner. This translation strategy is widespread among eukaryotic viruses and, while still considered a rarity in higher animal cells, there are reports of bicistronic mRNAs in plants, including the tomato tomPro1 locus and in Arabidopsis (see Farrell and Bassett, 2007 for a recent review). It is also pos- sible for a single-reading-frame mRNA to produce two or more polypeptides by cleavage of large precursor protein (a zymogen, for example), such as with the animal hormones oxytocin and vasopressin (Richter, 1983). These observa- tions have lead investigators to rethink the entire process of the regulation of gene expression and to analyze gene expression data circumspectly.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-613133630909223950?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/613133630909223950'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/613133630909223950'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/bicistronic-mrnas.html' title='Bicistronic mRNAs'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-5553617640122854923</id><published>2011-10-04T09:29:00.000-07:00</published><updated>2011-10-04T09:30:56.844-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Topology of a typical mRNA molecule'/><title type='text'>Topology of a typical mRNA molecule</title><content type='html'>&lt;div style="text-align: justify; font-family: trebuchet ms;"&gt; A   typical human fibroblast cell contains approximately 1 picogram (pg) of mRNA, which is equivalent to about 10 6   molecules transcribed from a particular subset of an estimated 25,000  –  30,000 genes. While this mRNA heterogeneity reflects the diversity of proteins that these mRNAs encode, a typical eukaryotic mRNA molecule shares several topological features with nearly all other mRNA molecules. As will become evident from the descriptions which follow, producing a function mRNA molecule is amazingly complex.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-5553617640122854923?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5553617640122854923'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5553617640122854923'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/topology-of-typical-mrna-molecule.html' title='Topology of a typical mRNA molecule'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6797842985117623323</id><published>2011-10-04T09:22:00.000-07:00</published><updated>2011-10-04T09:29:00.070-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Bioelectronic DNA'/><title type='text'>Bioelectronic DNA</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;b&gt;Bioelectronic DNA&lt;/b&gt; detection involves forming an electronic  circuit mediated by nucleic acid hybridization and it serves as  the  basis for a DNA detection system called eSensor™ .This system uses  low-density DNA chips containing electrodes coated with DNA capture  probes.Target DNA present in the ample hybridizes specifically both to  capture probes and ferrocene labeled signal probes in solution thereby  generating an electric current. Currente Sensor DNA chips contain as  many as 36 electrodes for simultaneous detection of multiple pathogens  from a single sample.&lt;br /&gt;Many pathogens cause both acute and chronic  disease at relatively low copy number and may be difficult or impossible  to propagate in culture. Thus, most pathogen detection systems rely on  nucleic acid amplification by using polymerase chain reaction (PCR). One  highly effective amplification strategy targets conserved sequences  among the family of organisms of interest. Such broad-range PCR  strategies have been used to identify and characterize several known and  previously uncharacterized bacteria and viruses. In order to maximize  the utility of these effective pathogen nucleic acid amplification  systems, amplification needs to be coupled with rapid, sensitive, and  specific detection.&lt;br /&gt;Bioelectronic DNA detection by use of the eSensor chip might fulfill this need.&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6797842985117623323?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6797842985117623323'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6797842985117623323'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/bioelectronic-dna.html' title='Bioelectronic DNA'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6307497737204888799</id><published>2011-10-04T09:20:00.000-07:00</published><updated>2011-10-04T09:22:22.386-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='RNA polymerases and the products of transcription'/><title type='text'>RNA polymerases and the products of transcription</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: verdana;"&gt; Genes are transcribed by enzymes known as RNA polymerases, thereby pro- ducing the major types of RNA, including ribosomal RNA (rRNA), transfer RNA (tRNA), and mRNA, as well as all of the smaller RNA species. Eukaryotic genes are transcribed by one of four nuclear RNA polymerases; these enzymes are among the largest and most complex proteins in the cell and consist of more subunits than their prokaryotic counterpart. The eukaryotic enzymes are properly known as RNA polymerases I, II, III, and IV, each of which is responsible for transcribing a different class of genes. Prokaryotes, in contrast, exhibit only one type of RNA polymerase, which transcribes all classes of RNA. RNA polymerases are active only in the presence of DNA, and require the nucleotides ATP, CTP, GTP, and UTP as precur- sors, myriad transcription factors. As is the case in the synthesis of all nucleic acid molecules, RNA transcripts are assembled only in the 5 → 3 direction. Transcription involves three distinct phases, namely, initiation, elongation, and termination, all of which have been described in great detail elsewhere and the details of which are beyond the scope of this volume. Briefly, initiation involves the attachment of RNA polymerase to a DNA template promoter, via transcription, activation, and initiation factors, followed by the acquisition of what will be the first ribonu- cleotide in the RNA molecule. Elongation involves the sequential addition of ribonucleotides to the nascent chain, a process also involving accessory protein elongation factors. Termination is the completion of RNA synthesis, whether appropriately or prematurely, and the disengagement of both the newly synthe- sized RNA and the RNA polymerase from the DNA template. Transcription termination, as with initiation and elongation, is sequence-dependent and is influenced by the presence of small proteins (termination factors) as well as the transient formation of RNA 2 ° structures. Mutations notwithstanding, the nucleotide sequence of the resulting RNA molecule is identical to the coding strand of the DNA from which it is derived, the only difference being the sub- stitution of the base uracil for thymine.&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6307497737204888799?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6307497737204888799'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6307497737204888799'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/rna-polymerases-and-products-of.html' title='RNA polymerases and the products of transcription'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6145100638833854461</id><published>2011-10-04T09:17:00.000-07:00</published><updated>2011-10-04T09:20:06.114-07:00</updated><category scheme='http://www.blogger.com/atom/ns#' term='Types of RNA'/><title type='text'>Types of RNA</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: verdana;"&gt; Transcription results in the production of RNA molecules, often generically referred to as transcripts. Traditionally, the transcripts observed within a cell  were broadly classified as ribosomal RNA (rRNA), transfer RNA (tRNA), heterogeneous nuclear RNA (hnRNA), or messenger RNA (mRNA), as well as a collection of small RNAs of previously unknown function. Now, however, one must include the extremely diverse population of miRNAs and other RNAs which are of immense interest in the study of the regulation of gene expression . Each category of RNA, which is synthesized by a different type of RNA polymerase, performs a different function in the cell. These highly diverse populations of RNA are not represented in equal amounts in the cell and the relative amount of each is directly related to the physiology of the cell. &lt;/span&gt;&lt;br /&gt;&lt;span style="font-family: verdana;"&gt; rRNA    is the most abundant RNA component in the cell. In prokaryotic cells the major rRNA species are the 23S rRNA, 16S rRNA, and 5S rRNA. The eukaryotic counterparts are identified as the 28S rRNA, 18S rRNA, and 5S &lt;/span&gt;&lt;span style="font-family: verdana;"&gt;rRNA, as well as a fourth ribosomal transcript, the 5.8S rRNA. These molecules form the scaffolding of ribosomes, which become translationally competent when decorated with myriad ribosomal proteins. At present there are &lt;/span&gt;&lt;span style="font-family: verdana;"&gt;55 known prokaryotic ribosomal proteins and 82 known eukaryotic ribosomal proteins. Not all ribosomes are functional at any given time, and the existence of a pool of transiently inactive ribosomes is itself a regulator of gene expression. The super abundance of rRNA is often exploited as both an RNA mass loading control as well as internal molecular weight markers for electrophoresis.&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6145100638833854461?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6145100638833854461'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6145100638833854461'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/types-of-rna.html' title='Types of RNA'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-933675863460486771</id><published>2011-10-04T09:16:00.000-07:00</published><updated>2011-10-04T09:17:52.989-07:00</updated><title type='text'>three dimensions, and consider the shape  of a DNA helix</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Only the first two base-pairs are shown, but then we show all parts of the sugar–phosphate chains. These chains wrap as spirals around an imaginary cylindrical surface of radius 9Å, and each sugar ring is represented by a dot. a side view of the cylinder for just one of the two sugar–phosphate chains. Here the phosphates, P0, P1, P2, etc. – counting from the top – are drawn as open circles, and the same lengths of 6.0Å, 3.3Å, and 5Å that were found for our skew-ladder characterize the path of these phosphates through space. Finally, a top view along the vertical axis of the DNAcylinder. Again, for the sake of sim-plicity, only one chain is shown, and the phosphates along it arelabeled P0, P1,…, P10. Each successive phosphate in this view lies 3.3Å further away from us than the one before. The chain is shown with a break between P10 and P0, because P11 lies directly behind P0 in&lt;br /&gt;this view: it is 11  3.3Å  36Åfurther away from us, when we look down into the plane of the paper.&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-933675863460486771?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/933675863460486771'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/933675863460486771'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2011/10/three-dimensions-and-consider-shape-of.html' title='three dimensions, and consider the shape  of a DNA helix'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-321648294957868143</id><published>2010-08-02T10:17:00.000-07:00</published><updated>2010-08-02T10:18:28.404-07:00</updated><title type='text'>How Silica Spin Column DNA and RNA Preps Work</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;We give a lot of troubleshooting help on DNA and RNA isolation here at Bitesize Bio because almost everything we do in molecular biology requires DNA or RNA at the very first step.  These days, most labs use commercial kits, which employ spin columns, for the isolation of nucleic acids. The spin columns contain a silica resin that selectively binds DNA/RNA, depending on the salt conditions and other factors influenced by the extraction method.&lt;br /&gt;&lt;br /&gt;These kits make the whole process much easier and faster than the methods of old, when things are going well, but the downside of using a kit is that we don’t always know what is in the mysterious and proprietary set of solutions that each company uses in its kit, which makes troubleshooting more difficult.&lt;br /&gt;&lt;br /&gt;So in this article, I’ll explain in some detail  how silica spin filter kits work and what is going on at each step. I’ll also go over some common problems specific to silica columns that can be overcome or avoided with just a little extra understanding.&lt;br /&gt;&lt;br /&gt;Lysis:&lt;br /&gt;&lt;br /&gt;The lysis formulas may vary based on the whether you want DNA or RNA, but the common denominator is a lysis buffer containing a high concentration of chaotropic salt. Chaotropes destabilize hydrogen bonds, van der Waals forces,  and hydrophobic interactions. Proteins are destabilized, including nucleases, and the association of nucleic acids with water is disrupted setting up the conditions for the transfer to silica.&lt;br /&gt;&lt;br /&gt;Chaotropic salts include guanidine HCL, guanidine thiocyanate, urea, and lithium perchlorate.&lt;br /&gt;&lt;br /&gt;Besides the chaotropes, there is usually some detergents involved, to help with protein solubilization and lysis. There can also be enzymes used for lysis depending on the samples type. Proteinase K is one of these, and actually works very well in these denaturing buffers; the more denatured the protein, the better Proteinase K works. Lysozyme, however, does not work in the denaturing and so lysozyme treatment is usually done before adding the denaturing salts.&lt;br /&gt;&lt;br /&gt;One comment about plasmid preps, the lysis is very different than extraction for RNA or genomic DNA because the plasmid has to be separated from the genomic DNA first and if you throw in chaotropes, you’ll release everything at once and won’t be able to differentially separate the small circular DNA from the high molecular weight chromosome.  So, in plasmid preps the chaotropes are not added until after lysis and the salts are used for binding. An excellent in-depth article on alkaline lysis is here and also another article on the difference between genomic DNA and plasmid is available for further reading.&lt;br /&gt;&lt;br /&gt;Binding:&lt;br /&gt;&lt;br /&gt;The chaotropic salts are critical for lysis, but also for binding, as we discussed. Additionally, to enhance and influence the binding of nucleic acids to silica, alcohol is also added. Most of the time this is ethanol but sometimes it may be isopropanol. The percent ethanol and the volume has big effects. Too much and you’ll bring in a lot of degraded nucleic acids and small species that will influence UV260 readings and throw off some of your yields.  Too little, and it may become difficult to wash away all of the salt from the membrane.&lt;br /&gt;&lt;br /&gt;The important point here is that the ethanol influences binding and the amount added is optimized for whatever kit you are using. Modifying that step can help change what you recover so if you are having problems and want to troubleshoot recovery, that can be a step to evaluate further.&lt;br /&gt;&lt;br /&gt;Another way to diagnose problems is to save the flow-through after binding and precipitate it to see if you can find the nucleic acids you are searching for. If you used an SDS-containing detergent in lysis, try using NaCl as a precipitant to avoid contamination of the DNA or RNA with detergent.&lt;br /&gt;&lt;br /&gt;Washing Steps:&lt;br /&gt;&lt;br /&gt;Your lysate was centrifuged through the silica membrane and now your DNA or RNA should be bound to the column and the impurities, protein and polysaccharides, should have passed through.  But, the membrane is still dirty with residual proteins and salt. If the sample was from plants, there will still be polysaccharides, maybe some pigments too, left on the membrane, or if the sample was blood, the membrane might be tinted brown or yellow.&lt;br /&gt;&lt;br /&gt;The wash steps serve to remove these impurities.  There are typically two washes, although this can vary depending on the sample type. The first wash will often have a low amount of chaotropic salt to remove the protein and colored contaminants. This is always followed with an ethanol wash to remove the salts. If the prep is something that didn’t have a lot of protein to start, such as plasmid preps or PCR clean up, then only an ethanol wash is needed.&lt;br /&gt;&lt;br /&gt;Removal of the chaotropic salts is crucial to getting high yields and purity DNA or RNA. Some kits will even wash the column with ethanol twice. If salt remains behind, the elution of nucleic acid is going to be poor, and the A230 reading will be high, resulting in low 260/230 ratios.&lt;br /&gt;&lt;br /&gt;Dry Spin:&lt;br /&gt;&lt;br /&gt;After the ethanol wash, most protocols have a centrifugation step to dry the column. This is to remove the ethanol and is essential for a clean eluant. When 10 mM Tris buffer or water is applied to the membrane for elution, the nucleic acids can become hydrated and will release from the membrane. If the column still has ethanol on it, then the nucleic acids cannot be fully rehydrated.&lt;br /&gt;&lt;br /&gt;Skipping the drying step results in ethanol contamination and low yields. I do not see ethanol absorbance on the Nanodrop, so it won’t show up in your readings. The main indicators of a problem are that when you try to load the sample onto an agarose gel, the DNA will not sink. Even in the presence of loading dye.  Another indicator is that if you put the sample in the -20C, it doesn’t freeze.&lt;br /&gt;&lt;br /&gt;Elution:&lt;br /&gt;&lt;br /&gt;The final step is the release of pure DNA or RNA from the silica. For DNA preps, 10 mM Tris at a pH between 8-9 is typically used. DNA is more stable at a slightly basic pH and will dissolve faster in a buffer. This is true even for DNA pellets. Water tends to have a low pH, as low as 4-5 and high molecular weight DNA may not completely rehydrate in the short time used for elution. Elution of DNA can be maximized by allowing the buffer to sit in the membrane for a few minutes before centrifugation.&lt;br /&gt;&lt;br /&gt;RNA, on the other hand, is fine at a slightly acidic pH and so water is the preferred diluent. RNA dissolves readily in water.&lt;br /&gt;&lt;br /&gt;What other things can go wrong:&lt;br /&gt;&lt;br /&gt;Low yields: If you experience yields lower than you expected for a sample, there are many factors to think about. Usually it is a lysis problem. Incomplete lysis is a major cause of low yields. It could also be caused by incorrect binding conditions.  Make sure to use fresh high quality ethanol (100% 200 proof) to dilute buffers or for adding to the binding step. Low quality ethanol or old stocks may have taken on water and not be the correct concentration. If the wash buffer is not made correctly, you may be washing off your DNA or RNA.&lt;br /&gt;&lt;br /&gt;Low Purity: If the sample is contaminated with protein (low 260/280) then maybe you started with too much sample and the protein was not completely removed or dissolved.  If the sample has poor 260/230 ratio the issue is usually salt from the bind or the wash buffer. Make sure that the highest quality ethanol was used to prepare wash buffers and if the problem continues, give the colun an additional wash.&lt;br /&gt;&lt;br /&gt;Some samples have a lot more inhibitors compared to others. Environmental samples are especially prone to purity issues because humic substances are solubilized during extraction. Humics behave similarly to DNA and are difficult to remove from the silica column. For this type of sample, specialized techniques exist to remove the protein and humics prior to the column step.&lt;br /&gt;&lt;br /&gt;Degradation: This is more of a concern for RNA preps and an article that gives specific advice is here.  Mainly with RNA, degradation occurs from inproper storage of the sample or an inefficient lysis, assuming of course that you eluted with RNase-free water. For DNA preps, degradation is not a huge problem because for PCR, the DNA can be sheared and it works fine. But if you were hoping to not have so much sheared DNA, then you may have used too strong a lysis method.&lt;br /&gt;&lt;br /&gt;PCR Clean-up Special Considerations: The easiest of all the techniques, because it is simply adding a high concentration of binding salts (typically between 3-5 volumes of salt per volumes of PCR reaction) and centrifugation through the column. So when PCR Clean-up kits fail, it can be particularly frustrating.  The first question I ask people is “did you check the results of the PCR on a gel?” because you cannot UV check a PCR reaction and have an accurate reading. There is way too much in a PCR reaction absorbing UV at 260: nucleotides, detergents, salts, and primers. In my experience, a failure of a PCR clean-up kit to work frequently is caused by a PCR reaction that has failed and so there was nothing to clean up. But if you know you had a strong PCR product, the best approach is to just save your flow-through fraction after binding. If the DNA doesn’t bind, that’s where it is. You can always rescue it and then clean it up again. And then call tech support and ask for a replacement kit.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-321648294957868143?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/321648294957868143'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/321648294957868143'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/how-silica-spin-column-dna-and-rna.html' title='How Silica Spin Column DNA and RNA Preps Work'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6707482787014508223</id><published>2010-08-02T10:16:00.001-07:00</published><updated>2010-08-02T10:16:33.777-07:00</updated><title type='text'>co-extract DNA and RNA</title><content type='html'>&lt;p&gt;I am trying to co-extract DNA and RNA from body fluid stains (e.g.  blood, semen and saliva) for forensic casework which may have very small  amount of the biological sample. I am thinking of Allprep DNA/RNA micro  kit from Qiagen. However, I was told that the RLT buffer was not  designed for very small sample volumes or sizes so that the yield would  be very low. It was recommended to use QIAamp DNA Investigator instead,  but the DNA and RNA will be in the same tube which is not ideal for my  experiment. If I want to separate DNA and RNA, I would like to use ATL  and AL buffer from QIAamp DNA Investigator to start, and then transfer  the lysate to AllPrep DNA spin column to separate the DNA and RNA.  However, from my understanding, DNA binds to silica column at higher pH  (8-9) but RNA binds at acidic pH (4-5). I was not sure the pH of the ATL  and AL buffer from QIAamp DNA Investigator. I would like to have your  advise.&lt;/p&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6707482787014508223?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6707482787014508223'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6707482787014508223'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/co-extract-dna-and-rna.html' title='co-extract DNA and RNA'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7361932384549699157</id><published>2010-08-02T09:54:00.001-07:00</published><updated>2010-08-02T09:54:48.912-07:00</updated><title type='text'>Tagetes erectus, Marigold, Thin layer chromatography, Potential</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Herbal medicines originated from the ancient use of wild plants. Today, with the possibility of carefully controlling the cultivation of medicinal plants and even improving them genetically, it is possible to develop and market a wide variety and quality of herbal drugs of consistent chemical composition and excellent quality to treat various diseases. One of the important constituent of Tagetes erectus may possess that quality.1 Tagetes erectus belong to the family Compositae. It is a small shrub; the plant grows upto a height of 1-3 feet and spreads about 0.5-1 feet. The leaf is arranged in opposite to subopposite with pinnately compound leaf. Margin is denate with oblong in shape bears green in colour with a blade length less than 2 inch. The leaves are 4 to 11cm long and very deeply pinnatifid, with the lobes lanceolate, coarsely and sharply toothed, and 1 to 2.5cm long , the flowers are pale to deep yellow.2&lt;br /&gt;&lt;br /&gt;The leaves of Tagetes erectus were collected from the wild sources of Shirpur forest, and it was identified and authenticated by Dr. Sagar Kshirsagar, Dept. of Botany, SSVPS, College of science, Dhulia. A voucher specimen is placed in the Dept. of Pharmacognosy for further reference. The collected plants were washed, dried and were pulverized with the help of mechanical grinder and was passed through sieve no 40, and stored in closed vessels for future use. The fresh leaves were used for Microscopy Identification.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7361932384549699157?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7361932384549699157'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7361932384549699157'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/tagetes-erectus-marigold-thin-layer.html' title='Tagetes erectus, Marigold, Thin layer chromatography, Potential'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-3960523243396863605</id><published>2010-08-02T09:51:00.000-07:00</published><updated>2010-08-02T09:52:11.558-07:00</updated><title type='text'>Garlic as nutraceutical</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;It is evident that garlic has been used as a food product across the globe. Today it became inseparable part of our diet. Scholars around the world have proved garlic for its medicinal use in treatment &amp;amp; prevention of certain diseases. It possesses both curative and preventative properties; new focus is on its use in prevention of heart attack and cancer. By studying these properties of garlic it can be categorised as nutraceuticals.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-3960523243396863605?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3960523243396863605'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3960523243396863605'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/garlic-as-nutraceutical.html' title='Garlic as nutraceutical'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1751859046205785836</id><published>2010-08-02T09:50:00.000-07:00</published><updated>2010-08-02T09:51:12.936-07:00</updated><title type='text'>Benzopyrone, antitubercular, CHN analysis.</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;A number of natural and synthetic benzopyrone derivatives have been reported to exert anti microbial, anti tubercular and anti diabetic activity.1 Benzopyrones having chromen (γ- benzopyrone) moiety are associated with interesting physiological activities such as anti microbial, anti tubercular, antidiaetic, antiviral, anticancer, anti-inflammatory 2 etc.In view of these observations and our interest in the synthesis of biologically active biheterocycles possessing benzopyrone nucleus we modified benzopyrone ring to explore activities associated with this nucleus &amp;amp; evaluated them for anti tubercular activity.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1751859046205785836?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1751859046205785836'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1751859046205785836'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/benzopyrone-antitubercular-chn-analysis.html' title='Benzopyrone, antitubercular, CHN analysis.'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8008079007506228922</id><published>2010-08-02T09:48:00.000-07:00</published><updated>2010-08-02T09:50:09.295-07:00</updated><title type='text'>suitably designed Informed Consent Form (ICF)</title><content type='html'>&lt;div style="text-align: justify; font-family: webdings;"&gt;The study was approved by the Institutional ethics committee at kasturba hospital, manipal. A suitably designed Informed Consent Form (ICF) in different languages namely English, Kannada and Malayalam was prepared and used for the purpose of the study. In order to record the data for the study, a separate Case Record Form (CRF) was designed and used, which contains the details of the patients demographics, medical history, medication history, final diagnosis, laboratory investigations, study specific investigations, patient outcome analysis chart, adverse event reporting card, discharge medication and details of follow up visits. The American Urological Association Symptom Score3 (AUASS) was used to assess the severity of urinary symptoms and to check the effectiveness of the treatment. The AUA symptom index questionnaire consists of 7 questions. For the purpose of this study questions 2, 4 and 7 were assigned to irritative symptoms, while questions 1, 3, 5 and 6 were assigned to obstructive symptom sub scores. Total scores were classified as mild 0 to 7, moderate 8 to 19 and severe 20 to 35 symptoms, as recommended by the AUA measurement committee3. This questionnaire has been adopted worldwide and it is also known as the International Prostate Symptom Score (IPSS). The quality of life questionnaires4 were classified as delighted with score (0), pleased with score (1), mostly satisfied with score (2), mixed with score (3), mostly dissatisfied with score (4), unhappy with score (5) and terrible with score (6) was used to assess the quality of life of the patient with bladder outlet obstruction.This was a randomised controlled study conducted in the Dept. of Urology of Kasturba Hospital, Manipal from September 2008 to April 2009. Our first step was to identify the female patients with bladder outlet obstruction and male patients with BPH during ward rounds or with the help of the physician. Once the patient was identified, they were enrolled according to the study criteria and subject information sheet was explained in detail to the patient or patient‟s legally acceptable representatives and written inform consent was obtained from qualified patients prior to their enrolment. A detailed history, clinical examination, study specific investigations which includes Maximum Flow Rate (MFR), Post Voidal Residual Volume (PVR) and bladder thickness was done and the follow up details for all the patients was recorded in the CRF followed by assessment of American Urological Association symptom score (AUASS). The treatment patterns were analyzed with respect to medical treatment or surgical procedures adapted to the patient.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8008079007506228922?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8008079007506228922'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8008079007506228922'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/suitably-designed-informed-consent-form.html' title='suitably designed Informed Consent Form (ICF)'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-2441238555046936660</id><published>2010-08-02T09:45:00.002-07:00</published><updated>2010-08-02T09:46:21.496-07:00</updated><title type='text'>earthworms Eudrilus</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;The anthelminitic activity was carried out against earthworms Eudrilus species by Garg and Atal method at 2 mg/ ml concentration. Suspension of samples was prepared by triturating synthesized cyclic peptide (200 mg) with Tween 80 (0.5 %) and distilled water. The resulting mixture was stirred using mechanical stirrer for 30 min. The suspensions were diluted to contain 0.4 % w/v of the test samples. Suspension of the standard drug albendazole was prepared with the same concentration in a similar way.&lt;br /&gt;Three sets of five earthworms of almost similar sizes were placed in petri plates containing 50 ml suspension of Tween 80 (0.5 %) and distilled water. The paralyzing and death times were noted and their mean was calculated for triplicate sets. The death time was ascertained by placing the earthworms in warm water (50ºC) which stimulated the movement.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-2441238555046936660?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2441238555046936660'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2441238555046936660'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/earthworms-eudrilus.html' title='earthworms Eudrilus'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7281046921610763272</id><published>2010-08-02T09:45:00.001-07:00</published><updated>2010-08-02T09:45:35.297-07:00</updated><title type='text'>Candida albicans and Asperigillus niger</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;The synthesized cyclic peptide was screened for antifungal activity against Candida albicans and Asperigillus niger. A spore suspension in normal saline was prepared from culture of the test fungi on sabouraud‟s broth media. After transferring growth media, petri plates were inoculated with spore suspension. After drying, wells were made using agar punch and the test samples, reference drug (griseofulvin) (50μg/ml) and negative control (DMSO) were placed in labeled wells in each petri plate. The test samples were tested at the concentrations 25, 50, 100 μg/ml. The petri plates inoculated with fungal cultures were incubated at 25ºC for 48 hrs. Diameters of the zone of inhibition were calculated in triplicate sets. The diameters obtained for the test sample were compared with that produced by the standard drug griseofulvin.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7281046921610763272?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7281046921610763272'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7281046921610763272'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/candida-albicans-and-asperigillus-niger.html' title='Candida albicans and Asperigillus niger'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-4707222864041268257</id><published>2010-08-02T09:44:00.000-07:00</published><updated>2010-08-02T09:45:03.557-07:00</updated><title type='text'>Antibacterial Activity</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;The synthesized cyclic peptide was screened for antibacterial activity against Escherichia coli, Staphylococcus aureus and Bacillus subtilis using modified Kirby-Bauer disc diffusion method. A spore suspension in sterile distilled water was prepared from five days old culture of the test bacteria growing on nutrient broth media. About 20 ml of the growth was transferred into sterilized petri plates and inoculated with 1.5 ml of the spore suspension. Each petri plate was divided into five equal portions along the diameter to place one disc. Three discs of test sample were placed on three portions together with one disc reference drug ciprofloxacin (50μg/ml) and a disc impregnated with the solvent DMF as negative control. The test samples were tested at the concentrations 25, 50, 100 μg/ml. The petri plates inoculated with bacterial cultures were incubated at 37ºC for 18 hrs. Diameters of the zone of inhibition were calculated in triplicate sets.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-4707222864041268257?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4707222864041268257'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4707222864041268257'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/antibacterial-activity_02.html' title='Antibacterial Activity'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7560065002610766688</id><published>2010-08-02T09:43:00.000-07:00</published><updated>2010-08-02T09:44:30.557-07:00</updated><title type='text'>Synthesis of cyclic heptapeptide, cyclo(Gly-Tyr-Val-Pro-Leu-Trp-Pro)</title><content type='html'>&lt;div style="text-align: justify; font-family: courier new; font-weight: bold;"&gt;To synthesize cyclo(Gly-Tyr-Val-Pro-Leu-Trp-Pro) (14), 9.44 gm of linear heptapeptide unit(10 mmol) (13) was deprotected at carboxyl end using 0.36 gm of LiOH (15 mmol) to get Boc-Tyr-Val-Pro-Leu-Trp-Pro-Gly-OH (13a) following the same procedure as adopted for the synthesis of compounds 8a and 9a from compounds 8 and 9 respectively.&lt;br /&gt;&lt;br /&gt;The deprotected heptapeptide unit 13a (4.65 gm, 5 mmol) was dissolved in 50 ml of CHCl3 at 0ºC. To the above solution, 0.94 gm of pnp (6.7 mmol) was added and stirred at room temperature for 12 hrs. The reaction mixture was filtered and the filtrate was washed with 10% NaHCO3 solution (3 x 15 ml) until excess of pnp was removed and finally washed with 5% HCl (2 x 10 ml) to get the corresponding p-nitrophenyl ester Boc-Tyr-Val-Pro-Leu-Trp-Pro-Gly-O-pnp (13b). To compound 13b (4.20 gm, 4 mmol) dissolved in 35 ml of CHCl3, 0.91 gm of TFA (8 mmol) was added, stirred at room temperature for 1 hr and washed with 10% NaHCO3 solution (2 x 25 ml).&lt;br /&gt;&lt;br /&gt;Tyr-Val-Pro-Leu-Trp-Pro-Gly-O-pnp (13c), which was dissolved in 25 ml of CHCl3 and 2.3 ml of NMM (21 mmol) was added. Then all the contents were kept at 0ºC for 7 days. The reaction mixture was washed with 10% NaHCO3 until the byproduct p-nitrophenol was removed completely and finally washed with 5% HCl (3 x 15 ml). The organic layer was dried over anhydrous sodium sulphate. Finally, chloroform was distilled off and the crude cyclized product was crystallized from CHCl3 and n-hexane to get the pure compound 14.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7560065002610766688?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7560065002610766688'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7560065002610766688'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/synthesis-of-cyclic-heptapeptide.html' title='Synthesis of cyclic heptapeptide, cyclo(Gly-Tyr-Val-Pro-Leu-Trp-Pro)'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8137933697080784810</id><published>2010-08-02T09:41:00.002-07:00</published><updated>2010-08-02T09:42:33.852-07:00</updated><title type='text'>Synthesis of Boc-tri/tetrapeptide methyl esters</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;To synthesize Boc-Tyr-Val-Pro-OMe (11), 3.80 gm of dipeptide unit 8a (10 mmol) was coupled with 1.66 gm of amino acid methyl ester hydrochloride 4 (10 mmol) in the presence of DCC and NMM following the same procedure as adopted for the synthesis of Boc-dipeptide methyl esters 8-10. Similarly Boc-Leu-Trp-Pro-Gly-OMe (12) was prepared by coupling 3.36 gm of deprotected dipeptide unit 9a and 1.86 gm of 10a using DCC as the coupling agent and NMM as the base.&lt;br /&gt;&lt;br /&gt;To synthesize Boc-Tyr-Val-Pro-Leu-Trp-Pro-Gly-OMe (13), 4.77 gm of tripeptide unit 11 mmol was deprotected at carboxyl end to get Boc-Tyr-Val-Pro-OH (11a) following the same procedure as adopted for the synthesis of compounds 8a and 9a from compounds 9 and 10, respectively. Tetrapeptide unit (12) (5.85 gm, 10 mmol) was deprotected at amino end to get Leu-Trp-Pro-Gly-OMe&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8137933697080784810?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8137933697080784810'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8137933697080784810'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/synthesis-of-boc-tritetrapeptide-methyl.html' title='Synthesis of Boc-tri/tetrapeptide methyl esters'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-7465337211343895663</id><published>2010-08-02T09:41:00.001-07:00</published><updated>2010-08-02T09:41:36.731-07:00</updated><title type='text'>Synthesis of L-amino acid methyl ester hydrochlorides</title><content type='html'>&lt;div style="text-align: justify;"&gt;&lt;span style="font-family: courier new; font-weight: bold;"&gt;Thionyl chloride (0.73mL, 10 mmol) was slowly added to methanol (50 mL) at 0C and 1.15gm of L- proline (10 mmol) was added to the above solution. The resulting mixture was refluxed for 9 hrs at 110 ºC. Methanol was evaporated and the residue was triturated with ether at 0C until excess dimethyl sulphite was removed. The crude product was purified by recrystallization from methanol and ether at 0C to get L-proline methyl ester hydrochloride (4). Similarly, L-valine methyl ester hydrochloride (5), L-tryptophan methyl ester hydrochloride (6) and glycine methyl ester hydrochloride (7) were prepared by refluxing 1.17 gm of L-valine (10 mmol), 2.04 gm of L-tryptophan (10 mmol) and 0.75 gm of glycine (10 mmol) with 50 ml methanol in the presence of 0.73 ml of thionyl chloride (10 mmol).&lt;/span&gt;&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-7465337211343895663?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7465337211343895663'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/7465337211343895663'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/synthesis-of-l-amino-acid-methyl-ester.html' title='Synthesis of L-amino acid methyl ester hydrochlorides'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-169218512963717948</id><published>2010-08-02T09:39:00.000-07:00</published><updated>2010-08-02T09:40:36.775-07:00</updated><title type='text'>Bioactive cyclic heptapeptide cyclo</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;A new bioactive cyclic heptapeptide cyclo(Gly-Tyr-Val-Pro-Leu-Trp-Pro) was synthesized using the solution phase technique by cyclization of the linear peptide Boc- Gly-Tyr-Val-Pro-Leu-Trp-Pro after proper deprotection at carboxyl and amino terminals. All the coupling reactions were performed at room temperature utilizing dicyclohexylcarbodiimide (DCC) as the coupling agent and N-methylmorpholine (NMM) as the base. Structures of all new compounds were characterized by IR and 1HNMR. The synthesized cyclopeptide was screened for antimicrobial and anthelminitic activities and found to exhibit good antibacterial activity against Bacillus subtilis and moderate antifungal activity against Candida albicans and Asperigillus niger. In addition the cyclic peptide was found to exhibit good anthelminitic activity against earthworms Eudrilus species.&lt;br /&gt;&lt;br /&gt;Cyclic congeners possess unusual or modified amino acid residues and exhibit there bioactivities through binding to corresponding enzyme. This characteristic feature can allow bioactive cyclopeptides to act as therapeutic agents in this resistant world. Cyclopepetides having multiple peptide bonds are concerned with a wide spectrum of biological activities such as antimicrobial, anti-inflammatory, antimalarial, cyctotoxic, and antifungal activities. Cyclic peptides are more important compounds for medicinal purposes and represent an important class of natural products. Since only minute quantities are obtained from natural resources many of these compounds were attempted to synthesize in the laboratory. Keeping in view the biological potential of cyclic peptide as well as to obtain a bioactive compound in a good yield, the present investigation aimed at synthesis of cyclic heptapeptide cyclo(Gly-Tyr-Val-Pro-Leu-Trp-Pro) in a convenient and economical manner. Synthesized cyclic heptapeptide was evaluated for pharmacological activities. The antibacterial and antifungal activities were carried out against variety of pathogenic microorganism like Escherichia coli, Staphylococcus aureus, Bacillus subtilis and Candida albicans, Asperigillus niger. The anthelminitic activity was carried out against Eudrilus species of earthworms.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-169218512963717948?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/169218512963717948'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/169218512963717948'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/bioactive-cyclic-heptapeptide-cyclo.html' title='Bioactive cyclic heptapeptide cyclo'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-5418218711979731734</id><published>2010-08-02T09:33:00.002-07:00</published><updated>2010-08-02T09:34:28.998-07:00</updated><title type='text'>Synthesis of free acid</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Sodium hydroxide (0.89gm, 22.4mmol) in 25 ml water was slowly added with stirring to 2.01gm of 5-bromo-2-hydroxyaldehyde (10mmol) and 0.94gm of chloroacetic acid (10mmol). The mixture was heated on heating mantle to remove all the liquid and the residue was treated with 30 ml water. The mixture was cooled and filtered and clear solution was acidified with dilute hydrochloric acid. The aqueous layer was extracted with diethyl ether (2 x 25 ml). Combined organic extracts were dried over anhydrous sodium sulphate.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-5418218711979731734?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5418218711979731734'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5418218711979731734'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/synthesis-of-free-acid.html' title='Synthesis of free acid'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-5057983798231797255</id><published>2010-08-02T09:33:00.001-07:00</published><updated>2010-08-02T09:33:48.876-07:00</updated><title type='text'>Deprotection of dipeptide</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Deprotection of dipeptide at amino end (7a): Compound 7 (3.42 gm, 10mmol) was dissolved in 15 ml of chloroform and treated with 2.28 gm of trifluoroacetic acid (20 mmol). The resulting solution was stirred at room temperature for 1 hr and washed with 25 ml of saturated sodium hydrogen carbonate solution. The organic layer was dried over anhydrous sodium sulphate and concentrated under reduced pressure. The crude product was purified by recrystallization from mixture of chloroform and light petroleum ether (b.p. 40-60C) to get pure Leu-Pro-OMe.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-5057983798231797255?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5057983798231797255'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/5057983798231797255'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/deprotection-of-dipeptide.html' title='Deprotection of dipeptide'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1815944303535894125</id><published>2010-08-02T09:32:00.000-07:00</published><updated>2010-08-02T09:33:08.058-07:00</updated><title type='text'>Bromosalicyaldehyde</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Melting points were determined and uncorrected. The amino acids, di-tert-butyl pyrocarbonate (Boc2O), 5- Bromosalicyaldehyde, DCC and NMM were obtained from Spectrochem Limited, Himedia laboratories Limited mumbai and Sd-fine-chem Limited, Mumbai, India. The IR spectra were recorded on a Perkin Elmer Fourier transform infrared spectrophotometer using KBr pellets. The 1HNMR spectra were recorded on the Bruker Avance II-400 NMR spectrometer using CDCl3 as the solvent. The purity of all the compounds was controlled by TLC on silica gel G plates. Chloroform:Methanol (9:1 v/v) was used as developing solvent system and dark brown spots were detected on exposure to iodine vapours in a tightly closed chamber.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1815944303535894125?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1815944303535894125'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1815944303535894125'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/bromosalicyaldehyde.html' title='Bromosalicyaldehyde'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8535746010531798717</id><published>2010-08-02T09:31:00.000-07:00</published><updated>2010-08-02T09:32:21.309-07:00</updated><title type='text'>Anthelmintic Activity</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;The anthelminitic activity was carried out against earthworms Eudrilus species by Garg and Atal method at 2 mg/ ml concentration. Suspension of samples was prepared by triturating synthesized cyclic peptide (200 mg) with Tween 80 (0.5 %) and distilled water. Suspension of the standard drug albendazole was prepared with the same concentration in a similar way. The paralyzing and death times were noted and their mean was calculated for triplicate sets. The death time was ascertained by placing the earthworms in warm water (50ºC) which stimulated the movement.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8535746010531798717?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8535746010531798717'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8535746010531798717'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/anthelmintic-activity.html' title='Anthelmintic Activity'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8130523626134255837</id><published>2010-08-02T09:13:00.000-07:00</published><updated>2010-08-02T09:14:14.103-07:00</updated><title type='text'>Antibacterial Activity</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;The synthesized peptide derivatives were screened for antibacterial activity against Escherichia coli, Staphylococcus aureus and Bacillus subtilis using modified Kirby-Bauer disc diffusion method (DMF as a solvent).The test samples were tested at the concentrations 25, 50, 100 μg/ml. The petri plates inoculated with bacterial cultures were incubated at 37ºC for 18 hrs. The diameters obtained for the test sample were compared with that produced by the standard drug ciprofloxacin.&lt;br /&gt;&lt;br /&gt;The synthesized peptide derivatives were screened for antifungal activity against Candida albicans and Asperigillus niger. DMSO is used as negative control. The test samples were tested at the concentrations 25, 50, 100 μg/ml. The petri plates inoculated with fungal cultures were incubated at 25ºC for 48 hrs. Diameters of the zone of inhibition were calculated in triplicate sets. The diameters obtained for the test sample were compared with that produced by the standard drug griseofulvin.&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8130523626134255837?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8130523626134255837'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8130523626134255837'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/antibacterial-activity.html' title='Antibacterial Activity'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-2719995028476517031</id><published>2010-08-02T09:12:00.000-07:00</published><updated>2010-08-02T09:13:06.975-07:00</updated><title type='text'>Phenoxyacetic acid, amino acids, antibacterial, antifungal and anthelminitic.</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;Phenoxyacetic acid is among the most vital moieties which are associate with potent antidiabetic (Rival et al 2004), antimycobacterial (Yar et al 2007),diuretic (Lebedev et al 1985, Woltersdorf et al 1976, Bicking et al 1976), anti-inflammatory (Kunsch et al 2005, Shokol et al 2005), antibiotic (Grardin et al 1995), anti-obesity (Kiso et al 1999), diagnostic (Ohmomo et al 1989), inhibition of platelet aggregation (Meanwell et al 1993, Seiler et al 1994) activities. The review of literature has suggested that incorporation of amino acids and peptides into aromatic and heterocyclic congeners have resulted in compounds with potent bioactivities.&lt;br /&gt;&lt;br /&gt;Introducing an amino acid or peptide into aromatic compounds can increase the potency, decrease the toxicity and prolong its action. Among aromatics, phenolic compounds have wide range of activities. Further phenoxylation the resulting compound phenoxyacetic acid is obtained, which is well known for their biological potential. Thus keeping in view the biological potency of phenoxyacetic acids as well as taking advantage of biodegradability and biocompatibility of a novel series of substituted phenoxyacetic acid derivatives of amino acids and peptides have been synthesized with an anticipation to get potent agents with&lt;br /&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-2719995028476517031?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2719995028476517031'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2719995028476517031'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/phenoxyacetic-acid-amino-acids.html' title='Phenoxyacetic acid, amino acids, antibacterial, antifungal and anthelminitic.'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-1313324772577592198</id><published>2010-08-02T09:08:00.000-07:00</published><updated>2010-08-02T09:10:55.981-07:00</updated><title type='text'>Animal experiments</title><content type='html'>&lt;div style="text-align: justify; font-family: verdana;"&gt;&lt;span style="font-size:130%;"&gt;Pharmaceutical Undergraduate curriculum in India continues to follow an archaic syllabus set up decades ago, which has not kept pace with the technological progress. The Animal Physiology syllabus does not reflect the constraints imposed by the Prevention of Cruelty to Animals act of 1960 in the transport, care and experimentation.&lt;br /&gt;The CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals) was established under Prevention of Cruelty to Animals act of 1960. The Experiments on Animals (Control and Supervision) Amendment Rules (1998) and the Breeding of and Experiments on Animals (Control and Supervision) Rules (1998) gave powers to the CPCSEA.&lt;br /&gt;&lt;/span&gt;&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-1313324772577592198?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1313324772577592198'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/1313324772577592198'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2010/08/animal-experiments.html' title='Animal experiments'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6790665187839362054</id><published>2008-09-01T08:37:00.000-07:00</published><updated>2008-10-05T09:57:14.766-07:00</updated><title type='text'>Cell-Transistor-Hybrid</title><content type='html'>&lt;div style="text-align: justify;"&gt;Biological cells are able to receive, process, and transmit information.&lt;br /&gt;Connecting these cells to micro-electronic circuits opens up exciting new perspectives in bioelectronics, information technology, medical engineering and in sensor development. Living cells possess receptors of unmatched sensitivity that detect external signals of chemical nature (nutrients, hormones, neurotransmitters, changes in proton- or ion-concentration, etc.) or physical stimuli as a change in temperature, light, mechanical force, or even electromagnetic fields. These input parameters are processed by the cells. The internal “machinery” of the cell&lt;br /&gt;includes signal amplification cascades and logic connections of high non-linearity, but the details remain to be unveiled. The resulting output signal may generate many physiological reactions inside the cell, as the synthesis of specific  olecules, a change in gene expression or the storage of certain substances.&lt;br /&gt;The output signals also allow the cell to communicate with its environment and with other cells. In order to provide selective long-term cell-transducer interfaces in vitro, microtechnology is used for the development of planar arrays with large numbers of field-effect transistors or metal electrodes in the size of the individual cells. These arrays usually consist of a culture chamber with embedded chip. For metalelectrode arrays (MEAs), insulated conductor paths are patterned lithographically. Their opened metallic ends form the sensing electrodes. In addition, field-effect transistor (FET) arrays have been developed to record the electrical signals from cells. Modifications of standard FET fabrication processes lead to devices with metal-free gate electrodes. A variation of these devices is the so-called ion-sensitive field-effect transistor (ISFET). Its gate dielectric is modified to yield higher sensitivity for certain ions. Sufficient electrical coupling between the cell and the electrode for extracellular signal recording is achieved only if a cell or a part of a cell is located directly on top of the electrode.&lt;/div&gt;&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6790665187839362054?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6790665187839362054'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6790665187839362054'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/09/cell-transistor-hybrid.html' title='Cell-Transistor-Hybrid'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-4233652696370257004</id><published>2008-09-01T08:32:00.000-07:00</published><updated>2008-09-01T08:36:35.954-07:00</updated><title type='text'>Silicon-based Biochemical Sensors</title><content type='html'>Silicon-based microelectronics represents the platform of our modern information technology. In recent years, silicon technology has been utilized to couple data processing systems to chemical and biological structures, integrating ion-selective materials and simple biomolecules or even cells and cell systems. The main advantage of these (bio-)chemical sensors is the high sensitivity and selectivity of their chemical and biological component as well as the possibility of miniaturization down to the nanometer scale. (Bio-)chemical sensors have been developed as rugged and reliable devices for the rapid and quantitative detection of specific analytes. For example, enzymes allow to monitor the blood glucose concentration of diabetic patients, a pH electrode may adjust the proper fermentation routine for cheese&lt;br /&gt;production and sensors and catalysts control the car pollution. (Bio-)chemical sensors constitute an interdisciplinary interface between the environment and data processing systems. Moreover, because these sensors can be designed in a modular concept, the combination of single sensors to sensor arrays is possible. We present some examples of new silicon-based (bio-) chemical sensors, which have been developed in a collaboration between ISG (FZJ) and the University of Applied Sciences Aachen (Jülich division): • capacitive field-effect sensors as a combination of ionophores or enzymes and silicon technology, • a silicon-based multi-parameter hybrid ion-sensitive FET (ISFET) module suitable for sensor arrays, • a beetle/chip biologically sensitive field-effect transistor (BioFET) as a first step towards a bioelectronic device with extraordinary sensory abilities. All described (bio-)chemical sensors utilize the field effect to transfer the detected (bio-) hemical information to an electrical signal.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-4233652696370257004?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4233652696370257004'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4233652696370257004'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/09/silicon-based-biochemical-sensors.html' title='Silicon-based Biochemical Sensors'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-2979649331545631877</id><published>2008-08-19T11:51:00.000-07:00</published><updated>2008-08-19T11:53:54.187-07:00</updated><title type='text'>Electrical activity of cells</title><content type='html'>Cells form a membrane potential between the interior of the cell and the surrounding liquid. This po-tential normally has a value of -60 mV to –90 mV and is caused by an inhomogeneous distribution of ions and the different permeability of the membrane to these ions. The active transport of potassium and sodium ions into and out of the cell, respectively, is accom-plished by a number of sodium-potassium pumps scattered across the cell membrane (compare Figure 2). Each pump transports two ions of potassium into the cell for every three ions of sodium pumped out. This establishes a particular distribution of positively charged ions across the cell membrane, with more sodium present outside the cell than inside, and more potassium inside the cell than outside. The simplest way to derive an expression for the membrane potential assumes a system in thermody-namic equilibrium. This means that the electrochemical potential inside and outside the cell is equal. Therefore, however, an unhindered exchange through the permeable membrane has to be possible.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-2979649331545631877?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2979649331545631877'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2979649331545631877'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/08/electrical-activity-of-cells.html' title='Electrical activity of cells'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-8208362383406912466</id><published>2008-08-03T02:57:00.000-07:00</published><updated>2008-08-03T02:59:05.583-07:00</updated><title type='text'>What is artificial life?(synthetic biology)</title><content type='html'>To the untrained eye, the tiny, misshapen, fatty blobs on Giovanni Murtas's microscope slide would not look very impressive. But when the Italian scientist saw their telltale green fluorescent glint he knew he had achieved something remarkable - and taken a vital step towards building a living organism from scratch.&lt;br /&gt;&lt;br /&gt;The green glow was proof that his fragile creations were capable of making their own proteins, a crucial ability of all living things and vital for carrying out all other aspects of life.&lt;br /&gt;&lt;br /&gt;Though only a first step, the discovery will hasten efforts by scientists to build the world's first synthetic organism. It could also prove a significant development in the multibillion-dollar battle to exploit the technology for manufacturing commercially valuable chemicals such as drugs and biofuels or cleaning up pollution.&lt;br /&gt;&lt;br /&gt;The achievement is a major advance for the new field of "synthetic biology". Its proponents hope to construct simple bespoke organisms with carefully chosen components. But some campaigners worry about the new technology's unsettling potential and argue there should be a moratorium on the research until the ethical and technological implications have been discussed more widely.&lt;br /&gt;&lt;br /&gt;One of the field's leading lights is the controversial scientist Craig Venter, a beach bum turned scientific entrepreneur who is better known for sequencing the human genome and scouring the oceans for unknown genes on his luxury research yacht. The research institute he founded hopes to create an artificial "minimal organism". And he believes there is big money at stake.&lt;br /&gt;&lt;br /&gt;In an interview with Newsweek magazine earlier this year, Dr Venter claimed that a fuel-producing microbe could become the first billion- or trillion-dollar organism. The institute has already patented a set of genes for creating such a stripped-down creature.&lt;br /&gt;&lt;br /&gt;Ultimately, synthetic biologists hope to create the most efficient form of life possible, with the fewest genes needed to allow the organism to grow, replicate and proliferate. But researchers have approached the problem from two radically different directions. Dr Venter's team is starting with one of the simplest forms of cellular life known to science - the bacterium Mycoplasma genitalium, which causes urinary tract infections. By stripping out each of its 482 genes and observing the effect on the organism they have calculated that a core of 381 are vital for life.&lt;br /&gt;&lt;br /&gt;In contrast to this top-down approach, Dr Murtas, at the Enrico Fermi research centre at Roma Tre University in Italy, and Pier Luigi Luisi aim to build a living thing from the bottom up. "The bottom-up approach has the possibility of creating living systems from entirely non-living materials," said Tom Knight, an expert in synthetic biology at the Massachusetts Institute of Technology.&lt;br /&gt;&lt;br /&gt;"That's the real power of synthetic biology ... If you can take it apart into little bits and pieces and shuffle things around and put it back together and it still works, you can have much more confidence that you really understand what is going on."&lt;br /&gt;&lt;br /&gt;The Italian team's advance is to make simple cells which are essentially bags made up of a fatty membrane containing just 36 enzymes and purified ribosomes - microscopic components common to all cells which translate the genetic code into protein. The primitive cells are capable of manufacturing protein from one gene.&lt;br /&gt;&lt;br /&gt;The team chose a fluorescent green protein found in jellyfish because it was easy to see, using a microscope, when the protein is being made. "We are trying to minimise any system we put in place for the cell," said Dr Murtas. "We can prove at this point that we can have protein synthesis with a minimum set of enzymes - 36 at the moment." He hopes the project will teach him about the earliest stirrings of life in Earth's primeval slime some 3.5bn years ago.&lt;br /&gt;&lt;br /&gt;"It's impressive work," said Prof Knight. "Protein synthesis is a wonderful place to start, partly because it is so well understood and ... you can figure out what is going wrong relatively easily. But there is a lot more involved in making cells that are alive ... I think the bottom-up people have a long way to go."&lt;br /&gt;&lt;br /&gt;Dr Murtas acknowledges that his bags of enzymes are a long way from a fully functioning cell, but it is an important proof of principle - being able to make proteins is key for the cell to acquire new functions. Giving it the ability to grow, divide, partition components into daughter cells correctly and replicate DNA will be a major challenge, though. The team will report the work in the journal Biochemical and Biophysical Research Communications.&lt;br /&gt;&lt;br /&gt;Dr Murtas is now working on making cells which are capable of division - crucial if they are to be truly alive. As the membrane grows, the team hope it will reach a point where the cell becomes too big and so gives rise to a pair of daughter cells.&lt;br /&gt;&lt;br /&gt;In June, Dr Venter's research team announced that they had discovered how to carry out a "genome transplant". They showed they could move the genetic recipe of one species of Mycoplasma bacterium into another closely related species.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-8208362383406912466?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8208362383406912466'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/8208362383406912466'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/08/what-is-artificial-lifesynthetic.html' title='What is artificial life?(synthetic biology)'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-9039893821810319574</id><published>2008-08-03T02:49:00.000-07:00</published><updated>2008-08-03T02:54:56.361-07:00</updated><title type='text'>Artificial Cell Energy..</title><content type='html'>Professor Hywel Morgan at the University's School of Electronics &amp; Computer Science (ECS) and Dr Peter Roach at the School of Chemistry and their team have received a European grant (€450k) to create a system that can detect single molecules in biological solutions.&lt;br /&gt;&lt;br /&gt;They are using variants of molecules found in biology and creating 'senses' from electrical charges caused by the binding of the molecules to mimic the human nose. With this approach, the sensitivity of the device can be a thousand times better than the currently available electronic nose.&lt;br /&gt;&lt;br /&gt;The receptors, which will be housed within an artificial membrane, remain in a closed steady state until approached by smell molecules, when they will open and transmit an electrical signal which will indicate the nature of the odour.&lt;br /&gt;&lt;br /&gt;Professor Morgan comments: "Many medical diseases involve odour. A device such as ours could measure different hormones, diagnose diseases and even sniff for traces of explosives. Most odours are still mapped by humans. If we can find a way to replace this function with technology, we could use odour detection in many new areas."&lt;br /&gt;&lt;br /&gt;Scientists are developing the world's smallest, high-performance and low-power sensor in silicon which will have applications in biosensing and environmental.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-9039893821810319574?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/9039893821810319574'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/9039893821810319574'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/08/artificial-cell-energy.html' title='Artificial Cell Energy..'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-3392993545278325726</id><published>2008-07-29T06:16:00.000-07:00</published><updated>2008-07-29T06:17:04.239-07:00</updated><title type='text'>PCR primers sequences</title><content type='html'>Human papillomavirus (HPV) capture probe and PCR primers sequences.&lt;br /&gt;6 capture CAG AAT TGG TGT ATG TGG AAG A(N152)&lt;br /&gt;11 capture TAA TCT GAA TTA GTG TAT GTA GCA GAT TTA GAC A(N152)&lt;br /&gt;16 capture GTA GTT TCT GAA GTA GAT ATG G(N152)&lt;br /&gt;18 capture TGG TAG CAT CAT ATT GCC CAG G(N152)&lt;br /&gt;26 capture ATC AGA TGG TTT AAA TGG AGT GGA TGC(N152)&lt;br /&gt;31 capture TAC TAC TTT TAA ATG TAG TAT CAC(N152)&lt;br /&gt;35 capture ACT GTC ACT AGA AGA CAC AGC AGA ACA CA(N152)&lt;br /&gt;40 capture GGG GGA CTG TGT GGC ACC A(N152)&lt;br /&gt;42 capture AGC AGC TGT ATA TGT ATC ACC AGA TGT TGC AGT GGC TCA(N152)&lt;br /&gt;45 capture CTT AGT AGG GTC ATA TGT ACT TGG C(N152)&lt;br /&gt;51 capture TTG GGG AAA CCG CAG CAG TGG CAG GGC TA(N152)&lt;br /&gt;52 capture TAT GTG CTT TCC TTT TTA ACC T(N152)&lt;br /&gt;54 capture GTC AGA ATT ATT AAA GCT ATC CTG CG(N152)&lt;br /&gt;56 capture TTT TCG TGC ATC ATA TTT ACT TA(N152)&lt;br /&gt;58 capture GTA CCT TCC TTA GTT ACT TCA G(N152)&lt;br /&gt;59 capture CTG GTA GGT GTG TAT ACA TTA G(N152)&lt;br /&gt;66 capture CAC GGG CAT CAT ATT TAG TTA A(N152)&lt;br /&gt;68 capture TTA AAT TTA TTA GGA TCA TAA ATA TTT GGT A(N152)&lt;br /&gt;82 capture AAT GTT TGT GCA ACA GAT TGA GTA ACA GCT GTG(N152)&lt;br /&gt;83 capture GTT AGA GGC TGT GTA TTC ATT AGC(N152)&lt;br /&gt;84 capture GGT TTA TAT TCT GAT TCG GTG T(N152)&lt;br /&gt;globin capture AGC AAT AGA TGG CTC TGC CC(N152)&lt;br /&gt;globin primer GAA GAG CCA AGG ACA GGT AC&lt;br /&gt;globin rev primer BIOTIN CAA CTT CAT CCA CGT TCA CC&lt;br /&gt;HMB01 rev primer BIOTIN GCG ACC CAA TGC AAA TTG GT&lt;br /&gt;PGMY09F primer BIOTIN CGT CCC AAA GGA AAC TGA TC&lt;br /&gt;PGMY09G primer BIOTIN CGA CCT AAA GGA AAC TGA TC&lt;br /&gt;PGMY09H primer BIOTIN CGT CCA AAA GGA AAC TGA TC&lt;br /&gt;PGMY09I primer BIOTIN GCC AAG GGG AAA CTG ATC&lt;br /&gt;PGMY09J primer BIOTIN CGT CCC AAA GGA TAC TGA TC&lt;br /&gt;PGMY09K primer BIOTIN CGT CCA AGG GGA TAC TGA TC&lt;br /&gt;PGMY09L primer BIOTIN CGA CCT AAA GGG AAT TGA TC&lt;br /&gt;PGMY09M primer BIOTIN CGA CCT AGT GGA AAT TGA TC&lt;br /&gt;PGMY09N primer BIOTIN CGA CCA AGG GGA TAT TGA TC&lt;br /&gt;PGMY09P primer BIOTIN GCC CAA CGG AAA CTG ATC&lt;br /&gt;PGMY09Q primer BIOTIN CGA CCC AAG GGA AAC TGG TC&lt;br /&gt;PGMY09R primer BIOTIN CGT CCT AAA GGA AAC TGG TC&lt;br /&gt;PGMY11A primer GCA CAG GGA CAT AAC AAT GG&lt;br /&gt;PGMY11B primer GCG CAG GGC CAC AAT AAT GG&lt;br /&gt;PGMY11C primer GCA CAG GGA CAT AAT AAT GG&lt;br /&gt;PGMY11D primer GCC CAG GGC CAC AAC AAT GG&lt;br /&gt;PGMY11F primer GCT CAG GGT TTA AAC AAT GG&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-3392993545278325726?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3392993545278325726'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/3392993545278325726'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/07/pcr-primers-sequences.html' title='PCR primers sequences'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-2138611999571522060</id><published>2008-07-29T06:12:00.000-07:00</published><updated>2008-07-29T06:16:15.856-07:00</updated><title type='text'>HPV - DNA COADING</title><content type='html'>Table 2: HPV type and signal probe sequence.&lt;br /&gt;6 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TGT AGT TAC GGA TGC AC&lt;br /&gt;11 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CAG ATG CAG ATA GTG TCA T&lt;br /&gt;16 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CAG CGC ATA ATG ACA TAT TT&lt;br /&gt;18 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TAC AGG AGA CTG TGT AG&lt;br /&gt;26 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) AGA TGC TGT AGA TAA TGT AC&lt;br /&gt;31 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TGT TTG CAA TTG CAG CA&lt;br /&gt;35 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CAG ACA TAT TTG TTC TAC GG&lt;br /&gt;40 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TAA GGT TAA ATT AGT GCA ACG A&lt;br /&gt;42 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CAA AGA CAT GTT AGT ACT AC&lt;br /&gt;45 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) ACA GGA TTT TGT GTA GAG G&lt;br /&gt;51 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) ATA GTT AAA TTT GTA CTT CTG G&lt;br /&gt;52 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CAG CAC ATA AAG TCA TG&lt;br /&gt;54 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TGG ATG CTG TAG CAC AC&lt;br /&gt;56 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) ACT GTT CTG TAG CAG TAC T&lt;br /&gt;58 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TGC ATA ATG TCA TAT TAG TG&lt;br /&gt;59 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) GAA TAG AAG AAG TAG TAG AA&lt;br /&gt;66 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TGT GCT TTT AGC TGC AT&lt;br /&gt;68 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CAG CTG ATT CAG TAG TAG TA&lt;br /&gt;82 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CTA ATG GTT AAA TTG GTA GTT&lt;br /&gt;83 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) CTG TGT AGC AGG AGC TGA AA&lt;br /&gt;84 (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TGG TAG CAG CAC TAA TA&lt;br /&gt;Globin (N6) C(N6) G(N6) C(N6) GCT TA(N6) C(N6) G(N6) C(N6) TGA CTT TTA TGC CCA GAC CTG G&lt;br /&gt;Table 3: HPV type and target mimic oligonucleotide sequences&lt;br /&gt;6 ACC ACA CGC AGT ACC AAC ATG ACA TTA TGT GCA TCC GTA ACT ACA TCT TCC ACA TAC ACC AAT TCT GAT TAT AAA&lt;br /&gt;11 GTA CAA ATA TGA CAC TAT GTG CAT CTG TGT CTA AAT CTG CTA CAT ACA CTA ATT CAG ATT ATA AGG AAT ACA TGC G&lt;br /&gt;16 ACT ACA CGC AGT ACA AAT ATG TCA TTA TGT GCT GCC ATA TCT ACT TCA GAA ACT ACA TAT AAA AAT ACT AAC TTT AA&lt;br /&gt;18 ACC ACT CCC AGT ACC AAT TTA ACA ATA TGT GCT TCT ACA CAG TCT CCT GTA CCT GGG CAA TAT GAT GCT ACC AAA T&lt;br /&gt;26 GTA CTA ACC TTA CCA TTA GTA CAT TAT CTG CAG CAT CTG CAT CCA CTC CAT TTA AAC CAT CTG ATT ATA AAC AAT T&lt;br /&gt;31 ACC ACA CGT AGT ACC AAT ATG TCT GTT TGT GCT GCA ATT GCA AAC AGT GAT ACT ACA TTT AAA AGT AGT AAT TTT AA&lt;br /&gt;35 TGT AGT TGA TAC AAC CCG TAG TAC AAA TAT GTC TGT GTG TTC TGC TGT GTC TTC TAG TGA CAG TAC ATA TAA AAA T&lt;br /&gt;40 AGT TGT AGA CAC CAC TCG TAG CAC TAA TTT AAC CTT ATG TGC TGC CAC ACA GTC CCC CAC ACC AAC CCC ATA TAA T&lt;br /&gt;42 ACT ACC CGT AGT ACT AAC ATG ACT TTG TGT GCC ACT GCA ACA TCT GGT GAT ACA TAT ACA GCT GCT AAT TTT AAG G&lt;br /&gt;45 AAC ATT ATG TGC CTC TAC ACA AAA TCC TGT GCC AAG TAC ATA TGA CCC TAC TAA GTT TAA GCA GTA TAG TAG ACA T&lt;br /&gt;51 GTT GAT ACT ACC AGA AGT ACA AAT TTA ACT ATT AGC ACT GCC ACT GCT GCG GTT TCC CCA ACA TTT ACT CCA AGT A&lt;br /&gt;52 ACC ACT CGT AGC ACT AAC ATG ACT TTA TGT GCT GAG GTT AAA AAG GAA AGC ACA TAT AAA AAT GAA AAT TTT AAG&lt;br /&gt;54 GTA CTA ACC TAA CAT TGT GTG CTA CAG CAT CCA CGC AGG ATA GCT TTA ATA ATT CTG ACT TTA GGG AGT ATA TTA G&lt;br /&gt;56 GTA CTA ACA TGA CTA TTA GTA CTG CTA CAG AAC AGT TAA GTA AAT ATG ATG CAC GAA AAA TTA ATC AGT ACC TTA G&lt;br /&gt;58 ACC ACT CGT AGC ACT AAT ATG ACA TTA TGC ACT GAA GTA ACT AAG GAA GGT ACA TAT AAA AAT GAT AAT TTT AAG&lt;br /&gt;59 ACT ACT CGC AGC ACC AAT CTT TCT GTG TGT GCT TCT ACT ACT TCT TCT ATT CCT AAT GTA TAC ACA CCT ACC AGT&lt;br /&gt;66 ACT ACC AGA AGC ACC AAC ATG ACT ATT AAT GCA GCT AAA AGC ACA TTA ACT AAA TAT GAT GCC CGT GAA ATC AAT&lt;br /&gt;68 GTA CCA ATT TTA CTT TGT CTA CTA CTA CTG AAT CAG CTG TAC CAA ATA TTT ATG ATC CTA ATA AAT TTA AGG AAT A&lt;br /&gt;82 ACT ACT AGA AGT ACC AAT TTA ACC ATT AGC ACT GCT GTT ACT CAA TCT GTT GCA CAA ACA TTT ACT CCA GCA AAC T&lt;br /&gt;83 GTA CCA ATA TTA CTA TTT CAG CTG CTG CTA CAC AGG CTA ATG AAT ACA CAG CCT CTA ACT TTA AGG AAT ACC TCC G&lt;br /&gt;84 ACC ACC CGC AGC ACC AAT TTT ACT ATT AGT GCT GCT ACC AAC ACC GAA TCA GAA TAT AAA CCT ACC AAT TTT AAG&lt;br /&gt;globin GGG AGG GCA GGA GCC AGG GCT GGG CAT AAA AGT CAG GGC AGA GCC ATC TAT TGC TTA CAT TTG CTT CTG ACA CAA C&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-2138611999571522060?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2138611999571522060'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/2138611999571522060'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/07/hpv-dna-coading.html' title='HPV - DNA COADING'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-4180825110770297851</id><published>2008-07-29T06:04:00.001-07:00</published><updated>2008-07-29T06:12:31.150-07:00</updated><title type='text'>HPV Leavel</title><content type='html'>Many of the HPV target mimics tested resulted in a specific&lt;br /&gt;signal, with the exception of HPV types 16, 26, 35, 40, 42,&lt;br /&gt;51, 52, and 82. This nonspecific hybridization signal generally&lt;br /&gt;resulted from a long stretch of complementary&lt;br /&gt;sequences (6–8 bases) among the HPV types due to their&lt;br /&gt;close genetic relatedness. Nonspecific hybridization was&lt;br /&gt;eliminated by introducing a mismatched base to the complementary&lt;br /&gt;region in the signal probes for HPV types 16,&lt;br /&gt;26, 35, 42, and 82 and the capture probes for HPV types&lt;br /&gt;40, 42, 51, 52, and 82. For instance, the HPV 16 signal&lt;br /&gt;probe hybridized with both the HPV 16 target mimic (Fig.&lt;br /&gt;3, left panel) and the HPV 52 capture probe (Fig. 3, center&lt;br /&gt;panel). This cross-reactivity was eliminated by changing&lt;br /&gt;the second A base in the 5'-end of signal probe to a G base&lt;br /&gt;(Fig. 3, right panel). In addition, we demonstrated that&lt;br /&gt;one base modification of the signal probe (Fig. 3, left and&lt;br /&gt;right panels) generated minimal negative impact to the&lt;br /&gt;assay signal level.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-4180825110770297851?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4180825110770297851'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4180825110770297851'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/07/hpv-leavel.html' title='HPV Leavel'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-4502723601211255350</id><published>2008-07-29T05:40:00.000-07:00</published><updated>2008-07-29T05:41:20.789-07:00</updated><title type='text'>BIO-ELECTRONIC</title><content type='html'>Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences &lt;br /&gt;&lt;br /&gt;specific for HPV types. Electrically conductive signal probes were synthesized to be &lt;br /&gt;&lt;br /&gt;complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 &lt;br /&gt;&lt;br /&gt;region that was amplified by using consensus primers served as target DNA. The amplified &lt;br /&gt;&lt;br /&gt;target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA &lt;br /&gt;&lt;br /&gt;chip to allow for hybridization with complementary capture probes.&lt;br /&gt;Results&lt;br /&gt;&lt;br /&gt;Two bioelectric chips were designed and successfully detected 86% of the HPV types contained &lt;br /&gt;&lt;br /&gt;in clinical samples.&lt;br /&gt;Conclusions&lt;br /&gt;&lt;br /&gt;This model system demonstrates the potential of the eSensor platform for rapid and &lt;br /&gt;&lt;br /&gt;integrated detection of multiple pathogens.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-4502723601211255350?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4502723601211255350'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/4502723601211255350'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/07/bio-electronic.html' title='BIO-ELECTRONIC'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry><entry><id>tag:blogger.com,1999:blog-4884613931214794576.post-6120396128751622764</id><published>2008-07-29T05:21:00.000-07:00</published><updated>2008-07-29T05:26:15.300-07:00</updated><title type='text'>BioElectronic Will Chance Our Lifestyle......</title><content type='html'>Global emergence of pathogenic infectious diseases by both natural and intentional means &lt;br /&gt;&lt;br /&gt;presents a formidable challenge to infectious disease surveillance and response, namely &lt;br /&gt;&lt;br /&gt;timely and efficient pathogen detection. Many laboratory methods exist for identifying &lt;br /&gt;&lt;br /&gt;pathogens, but most require exquisite care in sample handling and processing prior to &lt;br /&gt;&lt;br /&gt;characterization of a pathogen. In addition, costly and perishable reagents, equipment, and &lt;br /&gt;&lt;br /&gt;supplies are required for sensitive and specific detection. The ideal detection system would &lt;br /&gt;&lt;br /&gt;integrate sample processing and pathogen characterization into a single automated device &lt;br /&gt;&lt;br /&gt;that would eliminate laborious, and time consuming sample processing and costly detection. &lt;br /&gt;&lt;br /&gt;Bioelectronic detection of nucleic acids on a miniature solid support is one of the first &lt;br /&gt;&lt;br /&gt;steps toward development of such an integrated detection device.&lt;div class="blogger-post-footer"&gt;&lt;img width='1' height='1' src='https://blogger.googleusercontent.com/tracker/4884613931214794576-6120396128751622764?l=bioelectronic.blogspot.com' alt='' /&gt;&lt;/div&gt;</content><link rel='edit' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6120396128751622764'/><link rel='self' type='application/atom+xml' href='http://www.blogger.com/feeds/4884613931214794576/posts/default/6120396128751622764'/><link rel='alternate' type='text/html' href='http://bioelectronic.blogspot.com/2008/07/bioelectronic-will-chance-our-lifestyle.html' title='BioElectronic Will Chance Our Lifestyle......'/><author><name>Pop's World</name><uri>http://www.blogger.com/profile/04964875113190825498</uri><email>noreply@blogger.com</email><gd:image rel='http://schemas.google.com/g/2005#thumbnail' width='16' height='16' src='http://img2.blogblog.com/img/b16-rounded.gif'/></author></entry></feed>
