Amplified representations of genomic DNA samples were prepared according to the scheme depicted in Fig. 1⇓ . DNA was first digested with the methylation-sensitive restriction enzyme, HpyCh4IV (New England Biolabs). After digestion, linker/adapters were ligated, and the PCR was performed with a linker primer. The linker sequence (CTAGGAGCTGGCAGATCGTACATTGACG) and PCR conditions were adapted as previously described(2). As shown in Fig. 1⇓ , the linker was designed so that when it ligated to the overhang created by HpyCh4IV digestion, it created a site for the relatively rare–cutting restriction enzyme, MluI (New England Biolabs). After linker ligation, the PCR was performed for 18 cycles. PCR products were then bound to streptavidin-coated paramagnetic beads (Promega), and the bound DNA was released from the beads by MluI digestion. The resulting DNA fragments were self-ligated by the addition of T4 DNA ligase (New England Biolabs) and then amplified with a commercial multiple strand displacement (MSD) amplification kit (illustra GenomiPhi V2 DNA Amplification Kit; GE Healthcare Life Sciences) according to the manufacturer’s instructions.
Sunday, January 1, 2012
Bioelectronic DNA detection involves forming an electronic circuit mediated by nucleic acid hybridization and it serves as the basis for a DNA detection system called eSensor™ [1-4]. This system uses low-density DNA chips containing electrodes coated with DNA capture probes. Target DNA present in the sample hybridizes specifically both to capture probes and ferrocene labeled signal probes in solution thereby generating an electric current. Currente Sensor DNA chips contain as many as 36 electrodes for simultaneous detection of multiple pathogens from a single sample.
Many pathogens cause both acute and chronic disease at relatively low copy number and may be difficult or impossible to propagate in culture. Thus, most pathogen detection systems rely on nucleic acid amplification by using polymerase chain reaction (PCR). One highly effective amplification strategy targets conserved sequences among the family of organisms of interest. Such broad-range PCR strategies have been used to identify and characterize several known and previously uncharacterized bacteria [5,6] and viruses [7,8]. In order to maximize the utility of these effective pathogen nucleic acid amplification systems, amplification needs to be coupled with rapid, sensitive, and specific detection. Bioelectronic DNA detection by use of the eSensor chip might fulfill this need.
Human papillomaviruses (HPV) serve as an ideal model system for determining the efficiency and feasibility of eSensor DNA detection technology since there are at least 30 distinct genital HPV types that can be effectively amplified with broad-range consensus PCR primers. We designed two eSensor chips, each containing 14 probes specific for the conserved L1 region of the HPV genome. We evaluated clinical cervical cytology samples known to contain one or more HPV types. The eSensor DNA detection platform successfully detected the correct HPV type in most of these clinical samples, demonstrating that the system provides a rapid, sensitive, specific, and economical approach for multiple-pathogen detection and identification from a single sample.Background We used human papillomaviruses (HPV) as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor) in identifying multiple pathogens.