Chromium DNA, and Soil Microbial Communities. DNA Working and RNA

Chromium DNA, and Soil Microbial Communities. DNA Working and RNA

The experiments were conducted on a previously uncontaminated soil amended with various levels of hexavalent Cr. Only 2-3% of the Cr was bio available 10 days after addition of the metal. Even though Cr bioavailability decreased rapidly, the bacterial community richness, as measured using denaturing gradient gel electrophoresis (DGGE), was reduced for both the 200 and 1000 mg kg-1 Cr treatments. One year after contamination, bacterial community richness had not returned to pre-disturbance levels. However, the fungal community had increased richness for the Cr-contaminated soils that was maintained for the duration of experiment. Changes in bacterial community richness were significantly related to both the total amount of Cr added and Cr bioavailability. From this research, there appears to be an antagonistic relationship between the fungal and bacterial communities stressed by Cr, which is significantly related to the total metal in the system. Due to technical problems with the amplification of DNA isolated from these chromium containing soils, I hypothesized that Cr was extracted along with the DNA isolated directly from soil. Using size exclusion chromatography with inductively coupled plasma mass spectrometry (SEC-ICP-MS), I determined the DNA extracts contained Cr. However, Cr was not free in solution indicating that inhibition of PCR was related to the environmental DNA samples containing low levels of Cr (0.5-0.7 ng g-1). To further understand the impact of Cr bound to DNA, DNA from an eight member model bacterial community was extracted in the presence of varying concentrations of Cr and community structure was measured using DGGE. The DGGE profiles of the DNA extracted in the presence of Cr had decreases in the number of bands corresponding to the model community, as well as decreases in the intensity of individual bands, as Cr concentrations increased. These results indicate that PCR-based molecular analyses of metal containing DNA may indicate altered community profiles that do not reflect actual changes in the community.

hydralazine-DNA pyrimidine interaction

hydralazine-DNA pyrimidine interaction

Hydralazine is a potent arteriolar vasodilator by producing relaxation of vascular smooth muscle.
The vasodilation is most marked in the splanchnic, coronary, cerebral and renal arterial beds.  Some of the symptoms may be caused by vasodilation and histaminic effects. Iron chelation may lead to anemia. (Alarcon-Segovia et al, 1967) A hydralazine-DNA pyrimidine interaction resulting in immune responses to hydralazine and  nuclear antigens in which antibodies to native DNA occur can explain the hydralazine-induced lupus erythematosus

STR Amplification and Detection

STR amplification systems can accommodate a range of template DNA concentrations. Most of the Promega PowerPlex^® STR systems provide optimal sister allele balance and locus-to-locus balance with 0.5–1.0ng of DNA template, and studies performed at Promega show that full profiles can be observed with less than 100pg (Ensenberger and Fulmer, 2009; McLaren, 2007; Krenke et al. 2005; Krenke et al. 2002). However, amplification and detection instrumentation can vary. You may need to optimize protocols, including cycle number and detection conditions (e.g., injection time or loading volume), for each laboratory instrument. Most of the PowerPlex^® systems use a thermal cycling program with 30 or 32 cycles for 0.5–1ng of purified DNA template. For larger amounts of input DNA (i.e., FTA^® paper) or to decrease sensitivity, fewer cycles should be evaluated. In-house validation should be performed to determine the optimal amplification and detection conditions.

The sensitive nature of PCR works in a lab's favor, but it can cause problems if great care is not taken to avoid contaminating the reaction with exogenous DNA. Three main categories of exogenous DNA have the biggest impact on DNA-typing laboratories: 1) DNA from the analyst, 2) DNA from other samples in the lab and 3) allelic ladder fragments. DNA from nonhuman sources, such as bacteria and fungi, will not be amplified and detected because STR systems are species-specific. Extreme care must be taken to avoid cross-contamination when preparing sample DNA, handling primer pairs, assembling amplification reactions and analyzing amplification products. Reagents and materials used prior to amplification should be stored separately from those used following amplification. Amplification reactions should be assembled in a room dedicated for reaction setup, using equipment and supplies reserved for amplification setup. We highly recommend the use of gloves and aerosol-resistant pipette tips. To detect reagent contamination, assemble a negative control reaction (i.e., no template) for every set of reactions, and scrutinize the reactions for the presence of unexpected peaks. After setting up reactions, wash all surfaces with a dilute bleach solution.

high-molecular-weight DNA Human Identification

high-molecular-weight DNA Human Identification

In the early days of DNA-based identification, the hypervariable regions of interest were variable number tandem repeat (VNTR) loci, which had a high level of heterozygosity and were relatively large in size (300–10,000bp) (Nakamura et al., 1987; Budowle et al., 1991). VNTRs were analyzed using restriction fragment length polymorphism (RFLP), where high-molecular-weight target DNA is digested with a restriction enzyme that has recognition sites at both ends of the hypervariable region. The size of the DNA fragment resulting from the restriction enzyme digestion is dictated by the number of repeat elements. These fragments are separated by size using agarose or polyacrylamide gel electrophoresis and detected using a labeled VNTR probe. Analysis of multiple VNTR loci results in a unique pattern of DNA fragments on the gel. The patterns generated from a DNA sample of unknown origin and DNA of known origin are compared. Matching patterns indicate that the sources of the unknown and known DNA samples are likely the same. RFLP analysis of VNTR loci works well to resolve immigration and paternity disputes and for other applications where large amounts of intact DNA can be collected. However, RFLP is not ideally suited to forensic investigations because microgram amounts of high-molecular-weight DNA are required.Thus, VNTR analysis is limited to investigations where large amounts of DNA are recovered.

Promega’s DNA isolation systems

The majority of Promega’s DNA isolation systems for genomic, plasmid and PCR product purification are based on purification by silica. Regardless of the method used to create a cleared lysate, the DNA of interest can be isolated by virtue of its ability to bind silica in the presence of high concentrations of chaotropic salts (Chen and Thomas, 1980; Marko et al. 1982; Boom et al. 1990). These salts are then removed with an alcohol-based wash and the DNA eluted in a low-ionic-strength solution such as TE buffer or water. The binding of DNA to silica seems to be driven by dehydration and hydrogen bond formation, which competes against weak electrostatic repulsion (Melzak et al. 1996). Hence, a high concentration of salt will help drive DNA adsorption onto silica, and a low concentration will release the DNA.

Promega has sold and supported silica-based DNA purification systems for nearly two decades. The first technology available was silica resin, exemplified by the Wizard® Plus Minipreps DNA Purification System. The protocol for purification by silica resin involves combining the cleared lysate with a resin slurry and using vacuum filtration to wash the bound DNA, followed by centrifugation to elute the purified DNA.

Ofloxacin Evaluation

Ofloxacin Evaluation

Most ocular treatments like eye drops and suspensions call for the topical administration of ophthalmically active drugs to the tissues around the ocular cavity. These dosage forms are easy to instill but suffer from the inherent drawback that the majority of the medication they contain is immediately diluted in the tear film as soon as the eye drop solution is instilled into the culde-sac and is rapidly drained away from the precorneal cavity by constant tear flow and lacrimo-nasal drainage.
The eye as a portal for drug delivery is generally used for local therapy against systemic therapy in order to avoid the risk of eye damage from high blood concentrations of the drug, which is not intended. The unique anatomy, physiology and biochemistry of the eye render this organ impervious to foreign substances, thus presenting a constant challenge to the formulator to circumvent the protective barriers of the eye without causing permanent tissue damage [‎ 1].
Therefore, only a very small fraction of the instilled dose is absorbed by the target tissue for this reason, concentrated solutions and frequent dosing are required
for the instillation to achieve an adequate level of therapeutic effect. One of the new classes of drug delivery systems, ocular inserts, which are gaining worldwide praise, release drugs at a pre-programmed rate for a longer period by increasing the precorneal residence time [‎ 2-‎ 4].
Ofloxacin is a pale yellow or bright yellow, crystalline powder. Ofloxacin is antibacterial and is the most commonly used fluroquinolone. It inhibits the enzyme bacterial DNA gyrase, which nicks double stranded DNA, introduces negative supercoils and then reseals the nicked ends. This is necessary to prevent excessive positive supercoiling of the strands when they separate to permit replication or transcription. The bactericidal action probably results from digestion of DNA by exonucleases whose production is signaled by the damaged DNA

Tramadol | analgesic | pain | cyclooxygenase

Tramadol | analgesic | pain | cyclooxygenase

pain is defined by the International Association for the Study of Pain (IASP) as "an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage".Pain has now been equated to a “fifth vital sign” highlighting the significance of pain management in patient care. Tramadol is a centrally acting analgesic, structurally related to codeine and morphine .It is effectively used to treat moderate-to-severe acute and chronic pain in diverse conditions. Tramadol is placed on the second step of WHO analgesic ladder and in contrast to traditional opioids, exerts its analgesic activity, a dual mechanism of action inhibiting transmission as well as perception of pain. Tramadol is more suitable than NSAIDs and coxibs for patient with GI, renal and cardiovascular problems. Combined with low dependence/abuse potential, it has proven to be of significant advantage over other agents, especially in the elderly.

Spherical crystallization | Flowability | Compactability | Bioavailability

Spherical crystallization | Flowability | Computability | Bioavailability

Spherical crystallization is a particle design technique, by which crystallization and agglomeration can be carried out simultaneously in one step and which has been successfully utilized for improvement of flowability, compactability and bioavailability of crystalline drugs. General methods of spherical crystallization are spherical agglomeration, emulsion solvent diffusion and ammonia diffusion method. The principle steps involved in the process of spherical crystallization are flocculation zone, zero growth zone, fast growth zone and constant size zone. Spherical crystallization is having wide applications in pharmaceuticals like improvement of flowability and compressibility of poorly compressible drugs, masking bitter taste of drugs and improving the solubility and dissolution rate of poorly soluble drug.

Dose for extended release Levofloxacin ocular

Dose for extended release Levofloxacin ocular

Levofloxacin is a fluoroquinolone antibacterial drug effective in the treatment of bacterial conjunctivitis and other ocular infections. Levofoxacin eye drop is available in the market for the treatment of anti bacterials
12.One drop of levofloxacin eye drop
= 0.05ml (approximately)

Quantity of drug instilled at one time (1-2
drops/time) = 250-500 µg

Quantity of drug instilled in one day (6-12
drops/ day) = 1500-3000 µg

The quantity of levofloxacin in the ocular insert can be between 1.5-3.0 mg for one day treatment using eye drops. Thus, 2.25 mg of levofloxacin is taken as the minimum required quantity for one day treatment. It was presumed that there would be a negligible loss of drug through ocular inserts when the drug is released at a constant rate over a period of 24hrs.
Assumption was also made that the ocular inserts will produce a better clinical response than the eye drops.

LEVOFLOXACIN DESIGN AND CHARACTERIZATION OF SUSTAINED RELEASE LEVOFLOXACIN

DESIGN AND CHARACTERIZATION OF SUSTAINED RELEASE LEVOFLOXACIN

Levofloxacin is a fluoroquinolone antibacterial drug effective in the treatment of bacterial conjunctivitis. The objective of the present work was to develop ocular inserts of levofloxacin and evaluate their potential for sustained ocular delivery. Conventional ophthalmic solution shows the poor bioavailability and therapeutic response due t many pre-corneal constraints.
These constrains necessitates the controlled and sustained drug delivery to become standard one in modern pharmaceutical era Matrix type ocular inserts were prepared by the film casting technique in Teflon coated Petri dishes and characterized in vitro by drug release studies using a flow through apparatus that simulated the eye conditions. Nine formulations were developed, which differed in the ratio of olymers - chitoson, polyvinyl alcohol (PVA). All the formulations were subjected to evaluation of thickness, weight variation, folding endurance, drug content uniformity, in vitro release study, Surface pH, Swelling Studies (Swelling Index), % Moisture absorption, Release Kinetics, and Ocular Irritation Studies.
On the basis of in vitro drug release studies, the formulation L9 was found to be better than the other formulations and it was selected as an optimized formulation.

RNA Reference Materials for Gene Expression Studies

This flowering of ingenuity is acceptable for hunting candidate genes with one format and verifying results by more common techniques, but for clinical applications, this variety is an obstacle. The typical application envisions a multiparametric “gene-expression signature” in which the expression patterns for many genes are combined to generate a “classifier” for diagnosis or prognosis. Laboratory 1, which uses array system brand A, publishes a well-designed study showing that a gene-expression signature distinguishes benign from malignant omphalomas. How should Laboratory 2, which uses brand X, adapt the “signature”? Clinical studies are also hampered by lack of well-defined controls. This problem is analogous to deciding, without benefit of reference materials, which of two immunoassays is better—when they use independently derived antibodies and different calibrators and controls—and then making this decision for 10 000 immunoassays at once. Some suppliers already provide tools to control for variation, including replicate probes, “spike-in” RNA controls, normalization algorithms, and image-quality metrics, but these also differ among formats. For comparing results among methods, it would be decidedly helpful to have widely available, standardized, renewable pools of RNA species that could monitor RNA purification, monitor cDNA labeling, verify sensitivity, and serve as controls.

During an actual assay, the APS could be cohybridized with a complex sample in two-color format. In the single-color format, the APS and the complex sample would have to be hybridized to separate arrays. The performance of a simple cRNA pool will not necessarily reflect performance of an array system with a more complex mixture. For such a format perhaps a complex sample could be labeled in parallel with and without addition of an APS, and then hybridized to separate arrays (recovery experiment).

The UHS (“spike-in” controls) would provide information on efficiency of cDNA synthesis/labeling, uniformity of hybridization, and sensitivity of detection. A pool added to samples before RNA purification could monitor that process. The utility of APS and UHS for QPCR is clear. The proposed number of materials exceeds needs but will not resolve the fundamental question of how best to normalize QPCR.

RNA Reference Materials for Gene Expression Studies

RNA Reference Materials for Gene Expression Studies

While walking up several flights of stairs in an elevator-deprived building recently, my colleague, between some gasps of breath, turned to me and exclaimed that he had to start his New Year’s resolution and begin exercising again. At that moment this seemed to me to be a very sensible thought, given his fish-like gasping and chameleon-like color changes. However, I also recalled that my colleague had a history of serious asthma and a travel schedule that rivaled most airline pilots. I asked him how he would be managing these challenges while seeking a more healthy lifestyle. He smiled at me and said that he would deal with these issues later. “Look”, he said, “at least getting some exercise is a start”.

The first steps in transitioning microarray- and quantitative reverse transcription-PCR (QRT-PCR)-based human-genome-wide RNA expression profiling from the current, primarily research, applications to the more exacting medical diagnostic and drug development arenas were made recently. The NIST organized a meeting in March 2003 (1) that focused singularly on establishing the types and properties of universal RNA reference materials to be used for expression-profiling assays. A summary of the proceedings and conclusions of the meeting is reported by Cronin et al. (2) in this issue. The principal conclusion of the workshop was that two types of RNA reference materials were needed: an Assay Process Control and an Array-Specific Hybridization reference material. The reported consensus of the meeting attendees was that such RNA reference materials would provide a measure of the accuracy, dynamic range, sensitivity, specificity, and reproducibility for the multiple types of currently available RNA expression technologies (arrays and QRT-PCR). Although acknowledging that there were several major challenges related to utilization of the proposed RNA reference materials and interpretation of results derived from their use, the authors of this report sounded a familiar refrain in their justification of focusing only on the goal of identifying and characterizing universal RNA reference materials. This was an important first step. Tackling associated implementation and interpretation issues was labeled as “beyond the scope of the March conference”. Memories of my colleague’s statement and the smile on his face came immediately to mind as the phrase “beyond the scope” was repeated several times in the report.

The goal of establishing measurable parameters to evaluate the performance of expression-profiling assays and instrumentation is indeed essential and almost self-evident. As described by Cronin et al. (2), approvals for new drugs or diagnostic tests using RNA profiling data as part of the data-submission process will be hampered unless acceptable and comparable reference materials are established for array- and QRT-PCR-derived data sets. As part of any performance evaluation effort, it is essential to identify and characterize control RNA reference materials that will be used by all RNA-profiling assay systems. The characteristics of both types of RNA reference materials were well described, and their utility was justified by the meeting attendees. However, the goal of the workshop to focus only on the RNA reference materials is troubling and leaves one with the same kind of unrealistic sense that filled me on the stairs with my colleague. Although the report clearly indicates that there are operational and contextual issues in the use of these reference materials, these challenges are viewed as separable from the purpose and the description of these reagents. Acknowledgments by the authors that there are troubling issues associated with the application of the proposed RNA reference materials does not help in achieving the goal of identifying measurable parameters by which expression-profiling assay systems can be evaluated. In fact, it may well be that these efforts will need to be revisited when some of these issues are eventually addressed.

Deferring the acknowledged issues catalogued by the authors jeopardizes the meeting’s efforts at identifying and using the characterized universal RNA reference materials, and this strategy seems to miss the integrated circumstances in which these materials will be used. Consider, for example, the combination of two deferred issues: not defining the biological background in which the standard RNA samples are to be tested and the desire to correlate results derived from cDNA- and oligonucleotide-based arrays. Testing of each the 96 and 12 suggested RNA transcripts comprising the Assay Process and Array Hybridization reference materials, respectively, is recommended to occur initially in a low-complexity hybridization background. Results from such an approach may well provide a misleading conclusion concerning the performance of any array system. Because the overwhelming majority of mRNAs to be monitored in a biological context are present at low copy numbers per cell (3), the capability of measuring the performance of an array system in the context of the competing related background sequences is integral.

An oligonucleotide array system tested in a low-complexity hybridization context with the RNA transcripts chosen for the Assay Process reference materials may be evaluated as being highly specific but less sensitive than a cDNA-based array system. However, in the context of a complex hybridization setting, lower specificity in a cDNA array system may lead to similar overall sensitivities for both the cDNA and oligonucleotide array systems. Thus, if initial testing and evaluation of expression-profiling systems is carried out in low-complexity hybridization conditions, performance results and impressions may well be misleading. Altering these impressions, if they are shown to be different in complex hybridization conditions, could be difficult and time-consuming. The identifications of specific RNA transcripts chosen as part of the Assay Process reference materials may themselves need to be reevaluated when used in a complex hybridization setting. Certain RNA transcripts may not be suitable to serve as low-copy-number reference standards because of the competitive-sequence-related transcripts present in a complex hybridization reaction. As one example indicating that membership of the RNA reference materials should be considered in the context of a complex hybridization setting is the observation that the number of pseudogenes in the human genome is now estimated to be nearly 20 000 (4).

The effect of deferring a solution to this single issue of hybridization complexity in which the RNA reference materials are to be used extends into other issues that will influence how the performance of any array- or QRT-RCR-based technology will be evaluated. The authors report in detail several issues related to the application of the recommended RNA reference materials (2). Among these is the issue of common algorithms or platform-modified algorithms used to calculate the detection and quantification of the proposed RNA reference materials. For the probes in both cDNA and oligonucleotide arrays, there is a quantitative relationship for each probe between true signal and concentration of the target. However, probe-sequence-specific behavior often clouds this relationship. The goal of all algorithms used by expression-profiling systems is to determine which probes are detecting the intended target in the sample mixture as opposed to sequence-related background and, in doing so, to provide the relative amount of detected target in one sample compared with another. Such algorithms may be dependent on estimating the probe-specific behavior. This estimation is based on the signal generated by the probe when there is no target in the sample and also when a range of target concentrations are present. In this latter case, the linearity of the relationship between the signal and the target concentration can be determined for each probe or collection of probes. In the absence of complex hybridization conditions, the value of RNA reference materials to help guide these estimations is dramatically reduced.

These issues have not gone entirely unattended. Recently, a collection of representatives from 20 different international academic, commercial, and governmental institutions, including NIST, have begun addressing this complex topic. This External RNA Control Consortium met in December 2003 to begin to explore the use of RNA controls in the context of the full complexity of expression-profiling experiments (5).

The interrelationships and dependencies of the issues summarized by Cronin et al. (2) for the proposed RNA reference materials are considerable. Focusing only on the characteristics of the RNA reference materials gives the impression that this is a way to begin to compartmentalize and simplify the standardization of elements to be used in the technologies used to measure expression profiling. Whitehead et al. (6) once said, “Seek simplicity and distrust it”. Deferring the challenges that are so closely interconnected with the use of the proposed universal RNA reference materials seems an ill-considered start and may create the illusion of progress on this important and complex topic.

Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood

Blood samples were collected from 1014 patients at 13 US clinic locations before they underwent an invasive prenatal procedure. All samples were processed to plasma, and the DNA extracted from 119 samples underwent massively parallel DNA sequencing. Fifty-three sequenced samples came from women with an abnormal fetal karyotype. To minimize the intra- and interrun sequencing variation, we developed an optimized algorithm by using normalized chromosome values (NCVs) from the sequencing data on a training set of 71 samples with 26 abnormal karyotypes. The classification process was then evaluated on an independent test set of 48 samples with 27 abnormal karyotypes.

RESULTS: Mapped sites for chromosomes of interest in the sequencing data from the training set were normalized individually by calculating the ratio of the number of sites on the specified chromosome to the number of sites observed on an optimized normalizing chromosome (or chromosome set). Threshold values for trisomy or sex chromosome classification were then established for all chromosomes of interest, and a classification schema was defined. Sequencing of the independent test set led to 100% correct classification of T21 (13 of 13) and T18 (8 of 8) samples. Other chromosomal abnormalities were also identified.

detection of aneuploidy

To test whether methylation-sensitive amplification and microarray analysis could be used to detect aneuploidy in mixed DNA samples, we performed experiments with artificial mixtures of TB and PB DNA with the intention of simulating the type of mixed sample that might actually be obtained from the plasma of a pregnant woman. DNA from 3 trisomic first-trimester TB samples (1 with trisomy 21 and 2 with trisomy 18) was each mixed with DNA prepared from the PB of a healthy female in a 1:9 ratio. Similarly, for each of these 3 DNA mixtures, we prepared a second mixture of first-trimester TB DNA from a chromosomally normal pregnancy of the opposite sex and female PB DNA in a 1:9 ratio. Thus, in both mixtures the DNA content was 90% from the PB sample and 10% from the TB sample. We then used the protocol described above to prepare methylation-sensitive representations from the mixtures. In each case, the total amount of starting DNA was 10 ng, with 1 ng being derived from the TB sample. Each mixture containing trisomic TB DNA was then compared with a mixture containing euploid TB DNA by hybridizing to the microarray described above.

For this analysis, we used a standard Qspline normalization procedure without color reversal. The signal associated with each chromosome was summarized by summing the number of array addresses either above or below a cutoff M value and calculating the ratio of the 2 sums. We then assessed these chromosome-specific ratios by computing a T score as described above. With this method, it was possible to detect the chromosome with known trisomy with a high degree of confidence. In practice, the best discrimination occurred when the analysis was based on approximately 10% of the data with the highest or lowest signal ratios (Fig. 4⇓ , black columns). These results show that aneuploidy can be confidently detected, despite the use of samples consisting of only 10 ng of total DNA, of which the trisomic component was only 10%. In all 3 cases, the X-chromosome difference stood out even more clearly than the autosomal trisomy.

dna amplification Result

we designed the amplification linker to ligate to the overhang left by HpyCh4IV digestion and simultaneously to create a site for the relatively rare–cutting enzyme, MluI. When amplification occurs as intended with the linkers ligated to HpyCh4IV sites, subsequent MluI digestion of products cleaves off the linker sequence. Because PCR is performed with a biotinylated primer, products can be bound to streptavidin-coated paramagnetic beads. In cases of illegitimate amplification, the fragment cannot be released from the paramagnetic beads by MluI digestion. In practice, this method was highly successful in reducing the proportion of nonspecific amplification products, as was shown by both sequencing of random PCR products and restriction digests of PCR products that had been subjected to a second round of amplification
Microarray analysis generally requires labeling of microgram quantities of DNA; however, the DNA yield from a linker-mediated PCR performed on only 1–10 ng of starting material is generally no greater than approximately 200 ng. To address the need for more DNA, we performed a second round of amplification with isothermal MSD, a procedure that provides an enormous degree of amplification while introducing little bias(7); however, MSD amplification has a strong preference for high molecular weight templates(8). To address this issue, we exploited the fact that after the process described above was completed, all PCR fragments had MluI sites at both ends. Self-ligation with T4 DNA ligase produced efficient polymerization of the low molecular weight fragments into higher molecular weight fragments that could be efficiently amplified via MSD

dna amplification

Amplified representations of genomic DNA samples were prepared according to the scheme depicted in Fig. 1⇓ . DNA was first digested with the methylation-sensitive restriction enzyme, HpyCh4IV (New England Biolabs). After digestion, linker/adapters were ligated, and the PCR was performed with a linker primer. The linker sequence (CTAGGAGCTGGCAGATCGTACATTGACG) and PCR conditions were adapted as previously described(2). As shown in Fig. 1⇓ , the linker was designed so that when it ligated to the overhang created by HpyCh4IV digestion, it created a site for the relatively rare–cutting restriction enzyme, MluI (New England Biolabs). After linker ligation, the PCR was performed for 18 cycles. PCR products were then bound to streptavidin-coated paramagnetic beads (Promega), and the bound DNA was released from the beads by MluI digestion. The resulting DNA fragments were self-ligated by the addition of T4 DNA ligase (New England Biolabs) and then amplified with a commercial multiple strand displacement (MSD) amplification kit (illustra GenomiPhi V2 DNA Amplification Kit; GE Healthcare Life Sciences) according to the manufacturer’s instructions.

What types of treatment decisions are based on KRAS status

Trial data showed that no colorectal carcinoma patient with an activating KRAS mutation has responded to treatment with anti-EGFR antibodies. Carcinomas from patients unresponsive to first-line therapy can be screened retrospectively for the presence of the activating KRAS point mutations in codons 12, 13, and 61 by use of DNA template extracted from paraffin blocks.

Wild-type KRAS is necessary but not sufficient for response to EGFR inhibitors in patients with metastatic colorectal cancer. In addition, it has been shown that mutated KRAS [and BRAF (v-raf murine sarcoma viral oncogene homolog B1)] is associated with poorer overall survival. Since approximately 40% of tumor specimens in patients with colorectal cancer will exhibit KRAS mutations, KRAS mutation analysis is critical when considering anti-EGFR therapy. Patients with tumors exhibiting KRAS mutations should be considered for other treatments. Unfortunately, this does limit therapeutic options, but clinical trials are now open that specifically address patients with KRAS-mutated tumors.

DNA Chips for the Clinical Laboratory

For the sake of accuracy, I want to update the readership on the most current information about the technology we have developed; some of this information may not have been available to Dr. McGlennen during the research for his review. Clinical Micro Sensors, Inc. (CMS; Pasadena, CA) was acquired by Motorola in June 2000 and is now part of Motorola Life Sciences. Dr. McGlennen’s paragraph on CMS (Motorola) focused on our ultimate vision of a point-of-care instrument for molecular diagnostics. Our vision is to integrate nucleic acid amplification and, ultimately, specimen preparation and to provide wireless communication of results to a laboratory information system, pharmacy, or physician along with transaction support and other features. For the near term, we have developed enabling technology for the clinical molecular diagnostics laboratory that exploits postamplification bioelectronic detection of nucleic acids (DNA or RNA targets) via hybridization to oligonucleotide capture probes on gold electrode arrays affixed to printed circuit boards or chips

Vesicle-Skin Interaction Study by Fluorescence Microscopy

Vesicle-Skin Interaction Study by Fluorescence Microscopy

Fluorescence microscopy was carried according to the protocol used for TEM and SEM study. Paraffin blocks are used, were made, 5-µm thick sections were cut using microtome (Erma optical works, Tokyo, Japan) and examined under a fluorescence micro Cytotoxicity Assay MT-2 cells (T-lymphoid cell lines) were propagated in Dulbecco's modified Eagle medium (HIMEDIA, Mumbai, India) containing 10% fetal calf serum, 100 U/mL penicillin, 100 mg/mL streptomycin, and 2 mmol/L L-glutamine at 37°C under a 5% CO2 atmosphere. Cytotoxicity was expressed as the cytotoxic dose 50 (CD50) that induced a 50% reduction of absorbance at 540 nm.

Filter Membrane-Vesicle Interaction Study by Scanning Electron Microscopy

Vesicle suspension (0.2 mL) was applied to filter membrane having a pore size of 50 nm and placed in diffusion cells. The upper side of the filter was exposed to the air, whereas the lower side was in contact with PBS (phosphate buffer saline solution), (pH 6.5). The filters were removed after 1 hour and prepared for SEM studies by fixation at 4°C in Karnovsky’s fixative overnight followed by dehydration with graded ethanol solutions (30%, 50%, 70%,90%, 95%, and 100% vol/vol in water).
Finally, filters were coated with gold and examined in SEM (Leica, Bensheim, Germany).

Advantages of Ethosomes

Advantages of Ethosomes

delivery systems:
1. Enhanced permeation of drug through skin for transdermal drug delivery.
2. Delivery of large molecules (peptides, protein molecules) is possible.
3. It contains non‐toxic raw material in formulation.
4. High patient compliance ‐ the ethosomal drug is administered in semisolid form (gel or cream) hence producing high patient compliance.
5. The Ethosomal system is passive, non‐invasive and is available for immediate commercialization.
6. Ethosomal drug delivery system can be applied widely in Pharmaceutical, Veterinary, Cosmetic fields.
7. Simple method for drug delivery in comparison to Iontophoresis and Phonophoresis and other complicated methods.